Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Advanced Search

Summary

Retrocopy Name Rps28P7
Plot displaying the genomic locations of a retrocopy (in chr5) and its respective parental gene (in chr17). Each line represents a retrocopy.
Species Mus musculus
Coordinates chr5:134492070-134492392  UCSC
Strand +
Parental Sequence NM_016844.3
Parental seq. overlap 315 bp
Parental seq. overlap (%) 80.4%
Genomic Region Intergenic
Retrocopy Summary Rps28P7, located on chr5:134492070-134492392, is a retrocopy of the parental gene Rps28. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name Rps28
Full Name ribosomal protein S28
Also known as -
Coordinate chr17:34042010-34043536
Strand -
Gene summary Predicted to be a structural constituent of ribosome. Predicted to be involved in cytoplasmic translation; maturation of SSU-rRNA; and ribosomal small subunit assembly. Predicted to be located in polysomal ribosome. Predicted to be part of cytosolic small ribosomal subunit. Is expressed in several structures, including cardiovascular system; extraembryonic component; genitourinary system; hemolymphoid system; and vitelline vein. Human ortholog(s) of this gene implicated in Diamond Blackfan anemia 15 with mandibulofacial dysostosis. Orthologous to human RPS28 (ribosomal protein S28). [provided by Alliance of Genome Resources, Apr 2022]

Homology

Species Scientific Name Retrocopy
Human Homo sapiens Without Homology
Chimpanzee Pan troglodytes Without Homology
Bonobo Pan paniscus Without Homology
Gorilla Gorilla gorilla Without Homology
Orangutan Pongo abelii Without Homology
Gibbon Nomascus leucogenys Without Homology
Green monkey Chlorocebus sabaeus Without Homology
Crab-eating macaque Macaca fascicularis Without Homology
Rhesus Macaca mulatta Without Homology
Baboon Papio anubis Without Homology
Golden snub-nosed monkey Rhinopithecus roxellana Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>Rps28P7
gcTCTCCGCCAGATCGCCGCCATCATGGACACGAGTCGCGTGCAGCCCTTCAAGCTGGCTAGGGTAACCAAAGTGCTGGGCAGGACCGGTTCGCAGGGACAGTGCACGCAGGTGCTAGTGGAATTTATGGATGACACCAGCCGCTCTATCATCCGAAATGTCAAAGGTCCCGTAAGAGAGGGTGACGTGCTCACCCTATTGGAGTCAGAAAGAGAAGCTCGAAGGTTGCGTTGATCTTGCAGCTGGGTTCTGGATATCCACTACTTAGCCCACGGAATGATCTGCAACTGTTAAATAAAGCATTTATATTAATTcttgtctag
>NM_016844.3
CTCGCGAGAGCGAAAGTGAGGCGTGGTCAGAGCCGACTATAAAAGGCATCCCCTGCTCACGTGACTCCTCTCCGCCAGATCGCCGCCATCATGGACACGAGTCGCGTGCAGCCCATCAAGCTGGCTAGGGTAACCAAAGTGCTGGGCAGGACCGGTTCGCAGGGACAGTGCACGCAGGTGCGAGTGGAATTCATGGATGACACCAGCCGCTCTATCATCCGAAATGTCAAAGGCCCCGTTCGAGAGGGTGACGTGCTCACCCTATTGGAGTCAGAAAGAGAAGCTCGAAGGTTGCGTTAATCTTGCAGCTGGGTTCTGGATATCCACTACTTAGCCCACGGAATGATCTGCAACTGTTAAATAAAGCATTTATATTAATTCTTGTCTAGAAA

Publications

PMID - Link Title