Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name RPL23AP61
Wait
Plot displaying the genomic locations of a retrocopy (in chr10) and its respective parental gene (in chr17). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr10:46063236-46063749  UCSC
Coordinates (T2T) chr10:46944128-46944641  UCSC
Coordinates (hg19) chr10:51532072-51532585  UCSC
Strand +
Parental Sequence NM_000984.6
Parental seq. overlap 479 bp
Parental seq. overlap (%) 49.3%
Genomic Region Intergenic
Retrocopy Summary RPL23AP61, located on chr10:46063236-46063749, is a retrocopy of the parental gene RPL23A. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name RPL23A
Full Name ribosomal protein L23a
Also known as L23A|MDA20
Coordinate chr17:28719985-28724359
Strand +
Gene summary Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L23P family of ribosomal proteins. It is located in the cytoplasm. The protein may be one of the target molecules involved in mediating growth inhibition by interferon. In yeast, the corresponding protein binds to a specific site on the 26S rRNA. This gene is co-transcribed with the U42A, U42B, U101A, and U101B small nucleolar RNA genes, which are located in its third, first, second, and fourth introns, respectively. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes RPL23AP46
Bonobo Pan paniscus RPL23AP48
Gorilla Gorilla gorilla RPL23AP46
Orangutan Pongo abelii RPL23AP46
Gibbon Nomascus leucogenys RPL23AP53
Golden snub-nosed monkey Rhinopithecus roxellana RPL23AP37
Green monkey Chlorocebus sabaeus Without Homology
Crab-eating macaque Macaca fascicularis Without Homology
Rhesus Macaca mulatta Without Homology
Baboon Papio anubis Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

The Genotype-Tissue Expression project - (GTEx)

Adipose SubcutaneousMuscle SkeletalArtery TibialArtery CoronaryHeart Atrial AppendageAdipose VisceralUterusVaginaBreast Mammary TissueSkin Not Sun ExposedMinor Salivary GlandBrain CortexAdrenal GlandThyroidLungSpleenPancreasEsophagus MuscularisEsophagus MucosaEsophagus Gastroesophageal JunctionStomachColon SigmoidSmall Intestine Terminal IleumColon TransverseProstateTestisNerve TibialSkin Sun ExposedHeart Left VentricleBrain CerebellumWhole BloodArtery AortaPituitaryBrain Frontal CortexBrain CaudateBrain Nucleus AccumbensBrain PutamenBrain HypothalamusBrain Spinal CordBrain HippocampusBrain Anterior Cingulate CortexOvaryBrain Cerebellar HemisphereLiverBrain Substantia NigraKidney CortexBrain AmygdalaCervix EctocervixFallopian TubeCervix EndocervixBladderKidney Medulla00.511.52
log10(TPM+1)

Massive Mining of Publicly Available RNA-seq Data from Human and Mouse - (ARCHS4)

AdiposeBone MarrowBreast Mammary TissueBrain CerebellumColonColon Colonic MucosaEsophagusHeartHeart VentricleKidneyLiverBrain MidbrainOvaryPancreasBrain PonsKidney CortexEye RetinaMuscle SkeletalSkinSmall IntestineBrain Spinal CordSpleenTestisThymusTracheaHeart ValveMuscle Smooth0123
log10(TPM+1)

Related Sequence

>RPL23AP61
TCCCTTTTCACAAGATGGCGCCGAAAGTGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCCGAAACCAAAGCGAAGGATTTAAAGGCCAAGAAGACAGTGTTGAAAGGTGTCCACAGCCACACAAAAAAAGAAGATCCGTACGTCACCCACCTTCCGGCGGCCCAAGACGCTGCAACTCCCGAGGCAGCCCAAATATCTTTGGAAGAGCGCTCCCAGGAGATACAAGCTTGACCACTACGCTATCATCAAGTTTCCGCTGACCACTGAGTCACCACGAAGAAGATAGAAGACAACAACACACTTGTGTTCATTGTGGATGTTAAAGCCAACAAGCACCAGATCAAACAGGCTGTGAAGAAGTTCTAAGACATTGATGTGGCCAAGGTCAACACCGTGATTTGGCCTGATGGAGAGAAGAAGGAATATGTTTCACTGGCTCCTGATTACGATGCTCTGGATGTTGCCAACAAAATTGGAATAATCTAAACTGAGCCCAGCTGGCTAATTCTAAATAT
>NM_000984.6
ATTGGAGACCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAAGCCAAAGCGAAGGCTTTAAAGGCCAAGAAGGCAGTGTTGAAAGGTGTCCACAGCCACAAAAAGAAGAAGATCCGCACGTCACCCACCTTCCGGCGGCCGAAGACACTGCGACTCCGGAGACAGCCCAAATATCCTCGGAAGAGCGCTCCCAGGAGAAACAAGCTTGACCACTATGCTATCATCAAGTTTCCGCTGACCACTGAGTCTGCCATGAAGAAGATAGAAGACAACAACACACTTGTGTTCATTGTGGATGTTAAAGCCAACAAGCACCAGATTAAACAGGCTGTGAAGAAGCTGTATGACATTGATGTGGCCAAGGTCAACACCCTGATTCGGCCTGATGGAGAGAAGAAGGCATATGTTCGACTGGCTCCTGATTACGATGCTTTGGATGTTGCCAACAAAATTGGGATCATCTAAACTGAGTCCAGCTGCCTAATTCTGAatatatatatatatatatCTTTTCACCATATACATGCCTGTCTGTCAATTTCTGGTTGGGCTGGGAGGCCACACACACACACTGACATGACAGGGCTTGGGCAAGACTCCTGTTCTACTTATCCTTTTGAAATACCTCACCCTGCCACTCCACCATGTATGATCATTCCAGAGATCTTTGTGACTAGAGTTAGTGTCCTAGGAAAACCAGAACTCAGAACTTGCCTCCATGGTTGAGTAACAAGCTGTACAAGAACCCCTTTTATCCCTGGAAGAGGCTGTGTATGAAACCAATGCCCAGGGTTTGAAGGGTGTTAGCATCCATTTCAGGGGAGTGTGGATTGGCTGGCTCTCTGGTAGCATTTTGTCCTCACACACCCATCTACTATGTCCAACCGGTCTGTCTGCTTCCCTCACCCCTTGCCCAATAAAGGACAAGGACTTCAGAGGAGTA

Publications

PMID - Link Title
19123937Comparative analysis of processed ribosomal protein pseudogenes in four mammalian genomes.