Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Advanced Search

Summary

Retrocopy Name RPL34P1
Plot displaying the genomic locations of a retrocopy (in chr1) and its respective parental gene (in chr4). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr1:168210603-168210980  UCSC
Coordinates (T2T) chr1:167562110-167562487  UCSC
Coordinates (hg19) chr1:168179841-168180218  UCSC
Strand +
Parental Sequence NM_001319236.2
Parental seq. overlap 356 bp
Parental seq. overlap (%) 65.2%
Genomic Region Intergenic
Retrocopy Summary RPL34P1, located on chr1:168210603-168210980, is a retrocopy of the parental gene RPL34. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name RPL34
Full Name ribosomal protein L34
Also known as L34
Coordinate chr4:108620576-108630484
Strand +
Gene summary Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L34E family of ribosomal proteins. It is located in the cytoplasm. This gene originally was thought to be located at 17q21, but it has been mapped to 4q. Overexpression of this gene has been observed in some cancer cells. Alternative splicing results in multiple transcript variants, all encoding the same isoform. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Feb 2016]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes RPL34P2
Bonobo Pan paniscus RPL34P2
Gorilla Gorilla gorilla RPL34P2
Orangutan Pongo abelii RPL34P6
Gibbon Nomascus leucogenys RPL34P21
Green monkey Chlorocebus sabaeus RPL34P36
Crab-eating macaque Macaca fascicularis RPL34P4
Rhesus Macaca mulatta RPL34P4
Baboon Papio anubis RPL34P3
Golden snub-nosed monkey Rhinopithecus roxellana RPL34P14
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>RPL34P1
ACAGGCACTCAGAATGGTCCAGCATTTGATATACCATCGTAGGCTTTCCTACAATATAGCCTCTAACAAAACTAGGCTGTCCCAAACCCCAGGTAATAGAATTGTTTACTTTTATACCAAGAAGGTTGGGAAAGCACCAAAATCTGCATGTGGCATGTGCCCAGGCAGACTTTGAGGGGTTCGTGCTGTGAGACCTAAAGTTCTTATGAAATTGTCCAAAACAAAAAAACATGTCAGCAGGGAATATGGTGGTTCCATTTGTGCTAAATGTGTTCATGACAGGATCAAGCATGCTTTCCTTATCGAGGAGCAGAAAATTGTTGTGAAAGTGTTGAAGGCACAAGCACAGAGTCAAAAAGCTAAATAAAAAATGAAACT
>NM_001319236.2
CCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACGTAGGCTTTCCTACAATACAGCCTCTAACAAAACTAGGCTGTCCCGAACCCCTGGTAATAGAATTGTTTACCTTTATACCAAGAAGGTTGGGAAAGCACCAAAATCTGCATGTGGTGTGTGCCCAGGCAGACTTCGAGGGGTTCGTGCTGTAAGACCTAAAGTTCTTATGAGATTGTCCAAAACAAAGAAACATGTCAGCAGGGCCTATGGTGGTTCCATGTGTGCTAAATGTGTTCGTGACAGGATCAAGCGTGCTTTCCTTATCGAGGAGCAGAAAATCGTTGTGAAAGTGTTGAAGGCACAAGCACAGAGTCAGAAAGCTAAATAAAAAAATGAAACTTTTTTGAGTAATAAAAATGAAAAGACGCTGTATGTATGACTTTTTTTTTTTCTGTTGTAATGTGTTAGTATACAGATTTTGTTTCTGTATGGTATTTGGGGACCCTATAGTTTTTAGCAGATTACTTTTTCTTGTTTTGTTTGTTG

Publications

PMID - Link Title