Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name RPS20P45
Plot displaying the genomic locations of a retrocopy (in chr11) and its respective parental gene (in chr8). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr11:77813282-77813793  UCSC
Coordinates (T2T) chr11:77746492-77747003  UCSC
Coordinates (hg19) chr11:77524328-77524839  UCSC
Strand -
Parental Sequence NM_001023.4
Parental seq. overlap 469 bp
Parental seq. overlap (%) 90.2%
Genomic Region Intragenic (RSF1)
Retrocopy Summary RPS20P45, located on chr11:77813282-77813793, is a retrocopy of the parental gene RPS20. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name RPS20
Full Name ribosomal protein S20
Also known as S20|uS10
Coordinate chr8:56067254-56074506
Strand -
Gene summary Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S10P family of ribosomal proteins. It is located in the cytoplasm. This gene is co-transcribed with the small nucleolar RNA gene U54, which is located in its second intron. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Two transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Apr 2009]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes RPS20P24
Bonobo Pan paniscus RPS20P24
Gorilla Gorilla gorilla RPS20P23
Orangutan Pongo abelii RPS20P23
Gibbon Nomascus leucogenys RPS20P23
Green monkey Chlorocebus sabaeus RPS20P1
Crab-eating macaque Macaca fascicularis RPS20P25
Rhesus Macaca mulatta RPS20P27
Baboon Papio anubis RPS20P21
Golden snub-nosed monkey Rhinopithecus roxellana RPS20P32
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>RPS20P45
TTTGAGGAAGTCGCGGTGGTAGGTGCTGCGGCTCTGTGATCCGCAGGCTCCTGCTCCTTACTCACTACTGTTCGCTCTCGCCGAGGAACAAGTCGGTCAGGAAGCCGTGCAGCAGCTATGGCTTTGAAGGTTACCGGAAAAACACGCGTGGAGCTGGAGGTGGCAGTTCACCGAAATTGAATCACTCTAACGAGCCGCAACATAAAATCCCTGGAAAAGGTGTGTGCTGACTTCATCAGAGGAGCAGAGGCAAAGAATCTCCAAGTGAAAGGACCAGTTCGAATACCTACCAAGACTTTGAGAATCACTACAGAAAAAGTCCTTGTGGTGAAGGTTCTAAGACGTGGGATCCTTTCCAGATGAGAATCCACAAGCGACTCATTGACTTGCACAGTCCTTCTGAGATTGTTAAGCAGATTGCTTCCATCAGTTTGAGCCGGGAGTTGAGGTGAAAGTCACCATTGCAGATGCTTAAGTCAACTATTTTAATAAATTGATTACCAGTTGTTAAA
>NM_001023.4
CTTTTTGAGGAAGACGCGGTCGTAAGGGCTGAGGATTTTTGGTCCGCACGCTCCTGCTCCTGACTCACCGCTGTTCGCTCTCGCCGAGGAACAAGTCGGTCAGGAAGCCCGCGCGCAACAGCCATGGCTTTTAAGGATACCGGAAAAACACCCGTGGAGCCGGAGGTGGCAATTCACCGAATTCGAATCACCCTAACAAGCCGCAACGTAAAATCCTTGGAAAAGGTGTGTGCTGACTTGATAAGAGGCGCAAAAGAAAAGAATCTCAAAGTGAAAGGACCAGTTCGAATGCCTACCAAGACTTTGAGAATCACTACAAGAAAAACTCCTTGTGGTGAAGGTTCTAAGACGTGGGATCGTTTCCAGATGAGAATTCACAAGCGACTCATTGACTTGCACAGTCCTTCTGAGATTGTTAAGCAGATTACTTCCATCAGTATTGAGCCAGGAGTTGAGGTGGAAGTCACCATTGCAGATGCTTAAGTCAACTATTTTAATAAATTGATGACCAGTTGTTAA

Publications

PMID - Link Title