Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name COX6CP5
Plot displaying the genomic locations of a retrocopy (in chr11) and its respective parental gene (in chr8). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr11:7977660-7977811  UCSC
Coordinates (T2T) chr11:8056834-8056985  UCSC
Coordinates (hg19) chr11:7999207-7999358  UCSC
Strand +
Parental Sequence NM_004374.4
Parental seq. overlap 123 bp
Parental seq. overlap (%) 16.5%
Genomic Region Intergenic
Retrocopy Summary COX6CP5, located on chr11:7977660-7977811, is a retrocopy of the parental gene COX6C. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name COX6C
Full Name cytochrome c oxidase subunit 6C
Also known as -
Coordinate chr8:99877865-99893707
Strand -
Gene summary Cytochrome c oxidase, the terminal enzyme of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. It is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, and the nuclear-encoded subunits may be involved in the regulation and assembly of the complex. This nuclear gene encodes subunit VIc, which has 77% amino acid sequence identity with mouse subunit VIc. This gene is up-regulated in prostate cancer cells. A pseudogene has been found on chromosomes 16p12. [provided by RefSeq, Jul 2010]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes COX6CP16
Bonobo Pan paniscus LOC100994763P16
Green monkey Chlorocebus sabaeus LOC103237200P3
Baboon Papio anubis LOC101013819P14
Golden snub-nosed monkey Rhinopithecus roxellana LOC104679876P25
Gorilla Gorilla gorilla Without Homology
Orangutan Pongo abelii Without Homology
Gibbon Nomascus leucogenys Without Homology
Crab-eating macaque Macaca fascicularis Without Homology
Rhesus Macaca mulatta Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>COX6CP5
TGATTTTGAAGAGATGAAAAAGGTTGGTATCTTTTGGAATGCAAAGTGATATTGGAATGTAAAGAATTTCTGGGGATTGTGTTCCATGGAAGTTTGTCACTGGCCTACGTTCCTGAACTGTGAAACATGAATATGTGGGCAAAGGAATAGTT
>NM_004374.4
ATTCTGCGCCTGCGCGCGGCTACAGCACGGTTCGTTTTTCCTTTAGTCAGGAAGGACGTTGGTGTTGAGgttagcaTACGTATCAAGGACAGTAACTACCATGGCTCCCGAAGTTTTGCCAAAACCTCGGATGCGTGGCCTTCTGGCCAGGCGTCTGCGAAATCATATGGCTGTAGCATTCGTGCTATCCCTGGGGGTTGCAGCTTTGTATAAGTTTCGTGTGGCTGATCAAAGAAAGAAGGCATACGCAGATTTCTACAGAAACTACGATGTCATGAAAGATTTTGAGGAGATGAGGAAGGCTGGTATCTTTCAGAGTGTAAAGTAATCTTGGAATATAAAGAATTTCTTCAGGTTGAATTACCTAGAAGTTTGTCACTGACTTGTGTTCCTGAACTATGACACATGAATATGTGGGCTAAGAAATAGTTCCTCTTGATAAATAAACAATTAACAAATACTTTGGACAGTAAGTCTTTCTCAGTTCTTAATGATAATGCAGGGCACTTACTAGCATAAGAATTGGTTTGGGATTTAACTGTTTATGAAGCTAACTTGATTTCCGTGTTTTGTTAAAATTTCATTGTTCTAGCACATCTTTAACTGTGATAGTTTGTCCGTTTCATTGCAGTTACTTGGTCTTGGGCTATGGATTAAAAAGTGTTCTTCATGAGCCTGTAAGACTACTGTACTGTGGGCTCTAAGAAGAGATAGAATCCTAATAAAATCTATCCTTGGCCTTCA

Publications

PMID - Link Title