Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name DAD1P1
Wait
Plot displaying the genomic locations of a retrocopy (in chr12) and its respective parental gene (in chr14). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr12:24917851-24918285  UCSC
Coordinates (T2T) chr12:24787901-24788335  UCSC
Coordinates (hg19) chr12:25070785-25071219  UCSC
Strand -
Parental Sequence NM_001344.4
Parental seq. overlap 374 bp
Parental seq. overlap (%) 54%
Genomic Region Intragenic (BCAT1)
Retrocopy Summary DAD1P1, located on chr12:24917851-24918285, is a retrocopy of the parental gene DAD1. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name DAD1
Full Name defender against cell death 1
Also known as OST2
Coordinate chr14:22564907-22589224
Strand -
Gene summary DAD1, the defender against apoptotic cell death, was initially identified as a negative regulator of programmed cell death in the temperature sensitive tsBN7 cell line. The DAD1 protein disappeared in temperature-sensitive cells following a shift to the nonpermissive temperature, suggesting that loss of the DAD1 protein triggered apoptosis. DAD1 is believed to be a tightly associated subunit of oligosaccharyltransferase both in the intact membrane and in the purified enzyme, thus reflecting the essential nature of N-linked glycosylation in eukaryotes. [provided by RefSeq, Jul 2008]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes DAD1P1
Bonobo Pan paniscus DAD1P1
Gorilla Gorilla gorilla DAD1P1
Orangutan Pongo abelii DAD1P1
Gibbon Nomascus leucogenys DAD1P1
Green monkey Chlorocebus sabaeus DAD1P1
Crab-eating macaque Macaca fascicularis DAD1P1
Rhesus Macaca mulatta DAD1P1
Baboon Papio anubis DAD1P1
Golden snub-nosed monkey Rhinopithecus roxellana DAD1P1
Marmoset Callithrix jacchus DAD1P1
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

This retrocopy transcript is not present in the GTEx database for expression quantification.

This retrocopy transcript is not present in the ARCHS4 database for expression quantification

Related Sequence

>DAD1P1
GGTTCTTAGAAGAGTACTTAGCTCTACTCTGCAGTGTCTGAAGTTGCTGGATATATACCTGCTGTATAAACTGCTGACTAGGGCGCTGCAGTTTACTTACTGTCTTCTCATGGGGACCTTCCCCTTCAACTCTTTCCTCTTGGGTTTCACATCTTGGGTGGGGAGTTTCATCCTAGTAGTTTGCCTGAGAATACAGGTGAACCCACAGAACAAAGTGGACTTCGAAAGCATCTCCTTGGAGTGAGACTTTGCTTCTTTCTCTTTGCTAGCACCATCTTGTACCTTATCGTCATGAACTTTGTTGGCTGAATCATTCCCATTTACTTAATTGAAGAGTAAGAGACTGGAACAATGCTCACTTTGATTTTCCTGGATAAGAGTTAAGAGTTCTTGAGATGGCAGCTTGTTTGACACATGAATTTTCTTCAAATTTGT
>NM_001344.4
ACATCCGGTGTGGTCGACGGGTCCTCCAAGAGTTTGGGGCGCGGACCGGAGTACCTTGCGTGCAGTTATGTCGGCGTCGGTAGTGTCTGTCATTTCGCGGTTCTTAGAAGAGTACTTGAGCTCCACTCCGCAGCGTCTGAAGTTGCTGGACGCGTACCTGCTGTATATACTGCTGACCGGGGCGCTGCAGTTCGGTTACTGTCTCCTCGTGGGGACCTTCCCCTTCAACTCTTTTCTCTCGGGCTTCATCTCTTGTGTGGGGAGTTTCATCCTAGCGGTTTGCCTGAGAATACAGATCAACCCACAGAACAAAGCGGATTTCCAAGGCATCTCCCCAGAGCGAGCCTTTGCTGATTTTCTCTTTGCCAGCACCATCCTGCACCTTGTTGTCATGAACTTTGTTGGCTGAATCATTCTCATTTACTTAATTGAGGAGTAGGAGACTAAAAGAATGTTCACTCTTTGAATTTCCTGGATAAGAGTTCTGGAGATGGCAGCTTATTGGACACATGGATTTTCTTCAGATTTGCACTTACTGCTAGCTCTGCTTTTTATGCAGGAGAAAAGCCCAGAGTTCACTGTGTGTCAGAACAACTTTCTAACAAACATTTATTAATCCAGCCTCTGCCTTTCATTAAATGTAACCTTTTGCCTTCCAAATTAAAGAACTCCATGCCACTCCTC

Publications

PMID - Link Title
No publications available for this retrocopy