Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Advanced Search

Summary

Retrocopy Name RPL34P26
Wait
Plot displaying the genomic locations of a retrocopy (in chr13) and its respective parental gene (in chr4). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr13:50361377-50361797  UCSC
Coordinates (T2T) chr13:49581992-49582412  UCSC
Coordinates (hg19) chr13:50935513-50935933  UCSC
Strand -
Parental Sequence NM_001319236.2
Parental seq. overlap 393 bp
Parental seq. overlap (%) 72%
Genomic Region Intergenic
Retrocopy Summary RPL34P26, located on chr13:50361377-50361797, is a retrocopy of the parental gene RPL34. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name RPL34
Full Name ribosomal protein L34
Also known as L34
Coordinate chr4:108620576-108630484
Strand +
Gene summary Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L34E family of ribosomal proteins. It is located in the cytoplasm. This gene originally was thought to be located at 17q21, but it has been mapped to 4q. Overexpression of this gene has been observed in some cancer cells. Alternative splicing results in multiple transcript variants, all encoding the same isoform. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Feb 2016]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes RPL34P30
Bonobo Pan paniscus RPL34P27
Gorilla Gorilla gorilla RPL34P30
Gibbon Nomascus leucogenys RPL34P13
Green monkey Chlorocebus sabaeus RPL34P6
Crab-eating macaque Macaca fascicularis RPL34P36
Rhesus Macaca mulatta RPL34P34
Baboon Papio anubis RPL34P32
Golden snub-nosed monkey Rhinopithecus roxellana RPL34P38
Marmoset Callithrix jacchus RPL34P4
Orangutan Pongo abelii Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

The Genotype-Tissue Expression project - (GTEx)

Adipose SubcutaneousMuscle SkeletalArtery TibialArtery CoronaryHeart Atrial AppendageAdipose VisceralUterusVaginaBreast Mammary TissueSkin Not Sun ExposedMinor Salivary GlandBrain CortexAdrenal GlandThyroidLungSpleenPancreasEsophagus MuscularisEsophagus MucosaEsophagus Gastroesophageal JunctionStomachColon SigmoidSmall Intestine Terminal IleumColon TransverseProstateTestisNerve TibialSkin Sun ExposedHeart Left VentricleBrain CerebellumWhole BloodArtery AortaPituitaryBrain Frontal CortexBrain CaudateBrain Nucleus AccumbensBrain PutamenBrain HypothalamusBrain Spinal CordBrain HippocampusBrain Anterior Cingulate CortexOvaryBrain Cerebellar HemisphereLiverBrain Substantia NigraKidney CortexBrain AmygdalaCervix EctocervixFallopian TubeCervix EndocervixBladderKidney Medulla00.20.40.6
log10(TPM+1)

Related Sequence

>RPL34P26
CCTCTTCCGGGGACATTGTCTGCAGGCACTCAGAATGGTCCTGCGTTTGACACACCAACATAGGCTTTCCTACAATACAACCTCTAACAAAACTAAGCTGTCTGGAACCCCTGGTAATAGAATCATTTACCTTTATACCAAGAAGGTTGGGAAAGCACCAAAATCTACATGTGGTATGTGCCCAGGCAGACTTTGAGGGGTTCATGCTGTAAGACCTAAAATTCCTATGAGATTGTCCAAAACAAAGAAATATGTCAGCAGGGCCTATGGTGGTTCCATGTATGCTAAATGTGTTCATGACAGGATCAAGCATGCTTTCCTTATCGACGAAGAGAAAATCGTTGTGAAAGTGTTGAAGGCACAAGCACAGAGTCAGAAAGCTAAATAGAAAATGAAACTTATTAACAAAAATGAAAAGACT
>NM_001319236.2
CCTCTTCCGGGGACGTTGTCTGCAGGCACTCAGAATGGTCCAGCGTTTGACATACCGACGTAGGCTTTCCTACAATACAGCCTCTAACAAAACTAGGCTGTCCCGAACCCCTGGTAATAGAATTGTTTACCTTTATACCAAGAAGGTTGGGAAAGCACCAAAATCTGCATGTGGTGTGTGCCCAGGCAGACTTCGAGGGGTTCGTGCTGTAAGACCTAAAGTTCTTATGAGATTGTCCAAAACAAAGAAACATGTCAGCAGGGCCTATGGTGGTTCCATGTGTGCTAAATGTGTTCGTGACAGGATCAAGCGTGCTTTCCTTATCGAGGAGCAGAAAATCGTTGTGAAAGTGTTGAAGGCACAAGCACAGAGTCAGAAAGCTAAATAAAAAAATGAAACTTTTTTGAGTAATAAAAATGAAAAGACGCTGTATGTATGACTTTTTTTTTTTCTGTTGTAATGTGTTAGTATACAGATTTTGTTTCTGTATGGTATTTGGGGACCCTATAGTTTTTAGCAGATTACTTTTTCTTGTTTTGTTTGTTG

Publications

PMID - Link Title
19123937Comparative analysis of processed ribosomal protein pseudogenes in four mammalian genomes.