Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name RPL12P7
Plot displaying the genomic locations of a retrocopy (in chr14) and its respective parental gene (in chr9). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr14:68693098-68693538  UCSC
Coordinates (T2T) chr14:62899965-62900405  UCSC
Coordinates (hg19) chr14:69159815-69160255  UCSC
Strand +
Parental Sequence NM_000976.4
Parental seq. overlap 377 bp
Parental seq. overlap (%) 59.1%
Genomic Region Intergenic
Retrocopy Summary RPL12P7, located on chr14:68693098-68693538, is a retrocopy of the parental gene RPL12. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name RPL12
Full Name ribosomal protein L12
Also known as L12
Coordinate chr9:127447674-127451406
Strand -
Gene summary Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L11P family of ribosomal proteins. It is located in the cytoplasm. The protein binds directly to the 26S rRNA. This gene is co-transcribed with the U65 snoRNA, which is located in its fourth intron. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes RPL12P34
Bonobo Pan paniscus RPL12P31
Gorilla Gorilla gorilla RPL12P33
Orangutan Pongo abelii RPL12P38
Gibbon Nomascus leucogenys RPL12P3
Green monkey Chlorocebus sabaeus RPL12P38
Crab-eating macaque Macaca fascicularis RPL12P18
Rhesus Macaca mulatta RPL12P19
Baboon Papio anubis RPL12P21
Golden snub-nosed monkey Rhinopithecus roxellana RPL12P11
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>RPL12P7
CAAGTTCAACCCCAACAAGATCAAAGTCGTATACCTGAGGTGCACGAGTGGGGAAGTCAGTACTACATCTGCTCTGGTTCCTAAGATCAGCCCCCTGGGTCTGTCTCCAAAAAAGGCCAATGAGGACATCACCAAGACAAGTGACTGGAAGGGCCAGAGGATCCCAGTGAAACTGACGGTGCAGAACACACAGGCCAGATTCAAGTGGCATCTTCTGCCTCTGCAGTGATCATGAAAGCCCTTGAGGAACCACCAAGAGACAGAAACAAGCAGAAAAACATTAAGTACAGTGGAAATATCATTTGTGGTGAGATCATCAACATTGCCCAACAGATGCAGCACTGATCTTTAGCCAGAGAACTCTCTGGAATCATTAAAGAGATCGTGAGGACTGCCTAGTCTGTGGGCTGTAGTGTTGATGGCGCCACCCTCACGACATCA
>NM_000976.4
CCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCCGGGTTCATCCGACACCAGCCGCCTCCACCATGCCGCCGAAGTTCGACCCCAACGAGATCAAAGTCGTATACCTGAGGTGCACCGGAGGTGAAGTCGGTGCCACTTCTGCCCTGGCCCCCAAGATCGGCCCCCTGGGTCTGTCTCCAAAAAAAGTTGGTGATGACATTGCCAAGGCAACGGGTGACTGGAAGGGCCTGAGGATTACAGTGAAACTGACCATTCAGAACAGACAGGCCCAGATTGAGGTGGTGCCTTCTGCCTCTGCCCTGATCATCAAAGCCCTCAAGGAACCACCAAGAGACAGAAAGAAACAGAAAAACATTAAACACAGTGGGAATATCACTTTTGATGAGATTGTCAACATTGCTCGACAGATGCGGCACCGATCCTTAGCCAGAGAACTCTCTGGAACCATTAAAGAGATCCTGGGGACTGCCCAGTCAGTGGGCTGTAATGTTGATGGCCGCCATCCTCATGACATCATCGATGACATCAACAGTGGTGCTGTGGAATGCCCAGCCAGTTAAGCACAAAGGAAAACATTTCAATAAAGGATCATTTGACAACTGGTGGA

Publications

PMID - Link Title