Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Advanced Search

Summary

Retrocopy Name RPS2P80
Plot displaying the genomic locations of a retrocopy (in chr14) and its respective parental gene (in chr16). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr14:75838873-75839113  UCSC
Coordinates (T2T) chr14:70048013-70048253  UCSC
Coordinates (hg19) chr14:76305216-76305456  UCSC
Strand -
Parental Sequence NM_002952.4
Parental seq. overlap 202 bp
Parental seq. overlap (%) 21.3%
Genomic Region Intragenic (TTLL5)
Intragenic (TTLL10)
Retrocopy Summary RPS2P80, located on chr14:75838873-75839113, is a retrocopy of the parental gene RPS2. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name RPS2
Full Name ribosomal protein S2
Also known as LLREP3|S2
Coordinate chr16:1962058-1964826
Strand -
Gene summary Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S5P family of ribosomal proteins. It is located in the cytoplasm. This gene shares sequence similarity with mouse LLRep3. It is co-transcribed with the small nucleolar RNA gene U64, which is located in its third intron. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes RPS2P31
Bonobo Pan paniscus RPS2P32
Gorilla Gorilla gorilla RPS2P34
Orangutan Pongo abelii LOC100444622P33
Gibbon Nomascus leucogenys RPS2P41
Green monkey Chlorocebus sabaeus RPS2P58
Crab-eating macaque Macaca fascicularis RPS2P27
Rhesus Macaca mulatta RPS2P32
Pig Sus scrofa RPS2P8
Dolphin Tursiops truncatus RPS2P2
Horse Equus caballus RPS2P9
Baboon Papio anubis Without Homology
Golden snub-nosed monkey Rhinopithecus roxellana Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>RPS2P80
TGGGCTGCCTGGACAAGAACATGAAAATCAAGTCCCTGGAGCAGATCTCTCTCTTCTCCCTGCCCATCAAGGAATCTGAGATCATCGACATTTCTGGGGACACCCTCTCACAGGTGAGGTTTTGAAGACTATACTTGTGGCAAAAGCAGACCCACACTGGCCAGTGGACCAGGTTCAAGGCATTTGTTACCATAAGGGACTACAATGGCTACATCAGTCTGGATAATTGCTCCAAGGAGGC
>NM_002952.4
CTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGGGGCCCTGGTGGCCCTGGGATGGGGAACCGCGGTGGCTTCCGCGGAGGTTTCGGCAGTGGCATccggggccggggtcgcggccgtggacggggccggggccgaggccgcggAGCTCGCGGAGGCAAGGCCGAGGATAAGGAGTGGATGCCCGTCACCAAGTTGGGCCGCTTGGTCAAGGACATGAAGATCAAGTCCCTGGAGGAGATCTATCTCTTCTCCCTGCCTATTAAGGAATCAGAGATCATTGATTTCTTCCTGGGGGCCTCTCTCAAGGATGAGGTTTTGAAGATTATGCCAGTGCAGAAGCAGACCCGTGCCGGCCAGCGCACCAGGTTCAAGGCATTTGTTGCTATCGGGGACTACAATGGCCACGTCGGTCTGGGTGTTAAGTGCTCCAAGGAGGTGGCCACCGCCATCCGTGGGGCCATCATCCTGGCCAAGCTCTCCATCGTCCCCGTGCGCAGAGGCTACTGGGGGAACAAGATCGGCAAGCCCCACACTGTCCCTTGCAAGGTGACAGGCCGCTGCGGCTCTGTGCTGGTACGCCTCATCCCTGCACCCAGGGGCACTGGCATCGTCTCCGCACCTGTGCCTAAGAAGCTGCTCATGATGGCTGGTATCGATGACTGCTACACCTCAGCCCGGGGCTGCACTGCCACCCTGGGCAACTTCGCCAAGGCCACCTTTGATGCCATTTCTAAGACCTACAGCTACCTGACCCCCGACCTCTGGAAGGAGACTGTATTCACCAAGTCTCCCTATCAGGAGTTCACTGACCACCTCGTCAAGACCCACACCAGAGTCTCCGTGCAGCGGACTCAGGCTCCAGCTGTGGCTACAACATAGGGTTTTTATACAAGAAAAATAAAGTGAATTAAGCGTGTTA

Publications

PMID - Link Title