Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Advanced Search

Summary

Retrocopy Name COX6CP11
Wait
Plot displaying the genomic locations of a retrocopy (in chr14) and its respective parental gene (in chr8). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr14:77652704-77652963  UCSC
Coordinates (T2T) chr14:71862033-71862292  UCSC
Coordinates (hg19) chr14:78119047-78119306  UCSC
Strand -
Parental Sequence NM_004374.4
Parental seq. overlap 225 bp
Parental seq. overlap (%) 30.2%
Genomic Region Intergenic
Retrocopy Summary COX6CP11, located on chr14:77652704-77652963, is a retrocopy of the parental gene COX6C. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name COX6C
Full Name cytochrome c oxidase subunit 6C
Also known as -
Coordinate chr8:99877865-99893707
Strand -
Gene summary Cytochrome c oxidase, the terminal enzyme of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. It is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, and the nuclear-encoded subunits may be involved in the regulation and assembly of the complex. This nuclear gene encodes subunit VIc, which has 77% amino acid sequence identity with mouse subunit VIc. This gene is up-regulated in prostate cancer cells. A pseudogene has been found on chromosomes 16p12. [provided by RefSeq, Jul 2010]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes COX6CP17
Bonobo Pan paniscus LOC100994763P17
Gorilla Gorilla gorilla LOC101144243P14
Orangutan Pongo abelii COX6CP18
Gibbon Nomascus leucogenys LOC100588890P23
Golden snub-nosed monkey Rhinopithecus roxellana LOC104679876P10
Green monkey Chlorocebus sabaeus Without Homology
Crab-eating macaque Macaca fascicularis Without Homology
Rhesus Macaca mulatta Without Homology
Baboon Papio anubis Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

The Genotype-Tissue Expression project - (GTEx)

Adipose SubcutaneousMuscle SkeletalArtery TibialArtery CoronaryHeart Atrial AppendageAdipose VisceralUterusVaginaBreast Mammary TissueSkin Not Sun ExposedMinor Salivary GlandBrain CortexAdrenal GlandThyroidLungSpleenPancreasEsophagus MuscularisEsophagus MucosaEsophagus Gastroesophageal JunctionStomachColon SigmoidSmall Intestine Terminal IleumColon TransverseProstateTestisNerve TibialSkin Sun ExposedHeart Left VentricleBrain CerebellumWhole BloodArtery AortaPituitaryBrain Frontal CortexBrain CaudateBrain Nucleus AccumbensBrain PutamenBrain HypothalamusBrain Spinal CordBrain HippocampusBrain Anterior Cingulate CortexOvaryBrain Cerebellar HemisphereLiverBrain Substantia NigraKidney CortexBrain AmygdalaCervix EctocervixFallopian TubeCervix EndocervixBladderKidney Medulla00.050.10.15
log10(TPM+1)

Massive Mining of Publicly Available RNA-seq Data from Human and Mouse - (ARCHS4)

Related Sequence

>COX6CP11
GGGGGTCGCAGCTCTCTATAAGTTTGCTGTGGCTGAACCAAGAAAAAAGACATACACAGATTTCTACAGTAATTATGAGTTCAATGAAAGATTTTTGAGGAAATGAGGAAGGCTGGTATCTTTCAGAGTGCAAAGTGATTTGGGAATATAAAAAATTTATTTGAGTTGCATCACCTAGAAGTTTGTCACTGACTTGTGTTCTTGAACTAGAAACATGAATGTGTGGGCTAAGAAATAGTTTCTCTTGATAAAGAAACAAC
>NM_004374.4
ATTCTGCGCCTGCGCGCGGCTACAGCACGGTTCGTTTTTCCTTTAGTCAGGAAGGACGTTGGTGTTGAGgttagcaTACGTATCAAGGACAGTAACTACCATGGCTCCCGAAGTTTTGCCAAAACCTCGGATGCGTGGCCTTCTGGCCAGGCGTCTGCGAAATCATATGGCTGTAGCATTCGTGCTATCCCTGGGGGTTGCAGCTTTGTATAAGTTTCGTGTGGCTGATCAAAGAAAGAAGGCATACGCAGATTTCTACAGAAACTACGATGTCATGAAAGATTTTGAGGAGATGAGGAAGGCTGGTATCTTTCAGAGTGTAAAGTAATCTTGGAATATAAAGAATTTCTTCAGGTTGAATTACCTAGAAGTTTGTCACTGACTTGTGTTCCTGAACTATGACACATGAATATGTGGGCTAAGAAATAGTTCCTCTTGATAAATAAACAATTAACAAATACTTTGGACAGTAAGTCTTTCTCAGTTCTTAATGATAATGCAGGGCACTTACTAGCATAAGAATTGGTTTGGGATTTAACTGTTTATGAAGCTAACTTGATTTCCGTGTTTTGTTAAAATTTCATTGTTCTAGCACATCTTTAACTGTGATAGTTTGTCCGTTTCATTGCAGTTACTTGGTCTTGGGCTATGGATTAAAAAGTGTTCTTCATGAGCCTGTAAGACTACTGTACTGTGGGCTCTAAGAAGAGATAGAATCCTAATAAAATCTATCCTTGGCCTTCA

Publications

PMID - Link Title
No publications available for this retrocopy