Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name RPS24P37
Plot displaying the genomic locations of a retrocopy (in chr14) and its respective parental gene (in chr10). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr14:81332843-81333393  UCSC
Coordinates (T2T) chr14:75547625-75548175  UCSC
Coordinates (hg19) chr14:81799187-81799737  UCSC
Strand -
Parental Sequence NM_001142284.2
Parental seq. overlap 493 bp
Parental seq. overlap (%) 88%
Genomic Region Intragenic (STON2)
Retrocopy Summary RPS24P37, located on chr14:81332843-81333393, is a retrocopy of the parental gene RPS24. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name RPS24
Full Name ribosomal protein S24
Also known as DBA3|S24|eS24
Coordinate chr10:78033863-78056806
Strand +
Gene summary Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S24E family of ribosomal proteins. It is located in the cytoplasm. Multiple transcript variants encoding different isoforms have been found for this gene. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Mutations in this gene result in Diamond-Blackfan anemia. [provided by RefSeq, Nov 2008]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes RPS24P15
Bonobo Pan paniscus RPS24P12
Gorilla Gorilla gorilla RPS24P15
Orangutan Pongo abelii RPS24P16
Gibbon Nomascus leucogenys RPS24P18
Green monkey Chlorocebus sabaeus RPS24P18
Crab-eating macaque Macaca fascicularis RPS24P14
Rhesus Macaca mulatta RPS24P14
Baboon Papio anubis RPS24P12
Golden snub-nosed monkey Rhinopithecus roxellana RPS24P9
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>RPS24P37
TGTCTGAGGATAGACCGCCATCATGAATGACATGGTAACTATCTGAACTAGAAAGTTCATGACCAACCAACGACTTCAGAGGAAACAAATGGTCATTGACGTCCTTCACCCCGGGAAGGCAACAGTACCGTACCTAAGACAGAAATTCGGGAAAAACTAGCAAAAATGTACAAGACCACACTGGATGTCATCTTTGTACTTGGATTCAGAACTCATTTTGGTGGTGGCAAGACAACTGGCTTTGGCATGATTTATGATTTCTTGGATTATGCAAAGAAATATGAATCCAAACATAGACTTGTAAGACATGGTCTGTATGAGAAGAAAAAGAACTCAAGAAAGCAACAAGAGGGACACAAGAACAGAATGAGGAAAGTCAGGGGGACTGCAAAGGCCAAAGTTGGTGTCGCTAAAAAGAAATGAGGTGTCTAGCAGTGAGCTGTGGAGATTGGATCACAGCTGAAGGGGTAAAGGTGTTGCAATGATGTTATCTGTGGCCATTGTGGATTTTTCACAGGAAGATCAATAAACTAAAAACTTT
>NM_001142284.2
CTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTATCCGCACTAGAAAGTTCATGACCAACCGACTACTTCAGAGGAAACAAATGGTCATTGATGTCCTTCACCCCGGGAAGGCGACAGTGCCTAAGACAGAAATTCGGGAAAAACTAGCCAAAATGTACAAGACCACACCGGATGTCATCTTTGTATTTGGATTCAGAACTCATTTTGGTGGTGGCAAGACAACTGGCTTTGGCATGATTTATGATTCCCTGGATTATGCAAAGAAAAATGAACCCAAACATAGACTTGCAAGACATGGCCTGTATGAGAAGAAAAAGACCTCaagaaagcaacgaaaggaacgcaagaacagaatgaagaaagTCAGGGGGACTGCAAAGGCCAATGTTGGTGCTGGCAAAAAGAAATGAAGTGTCTAGCAGtgagctggagattggatcacagCCGAAGGAGTAAAGGTGCTGCAATGATGTTAGCTGTGGCCACTGTGGATTTTTCGCAAGAACATTAATAAACTAAAAACTTCA

Publications

PMID - Link Title