Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Advanced Search

Summary

Retrocopy Name ATP5PDP1
Wait
Plot displaying the genomic locations of a retrocopy (in chr15) and its respective parental gene (in chr17). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr15:43267844-43268419  UCSC
Coordinates (T2T) chr15:41075136-41075711  UCSC
Coordinates (hg19) chr15:43560042-43560617  UCSC
Strand -
Parental Sequence NM_006356.3
Parental seq. overlap 533 bp
Parental seq. overlap (%) 87.5%
Genomic Region Intergenic
Retrocopy Summary ATP5PDP1, located on chr15:43267844-43268419, is a retrocopy of the parental gene ATP5PD. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name ATP5PD
Full Name ATP synthase peripheral stalk subunit d
Also known as APT5H|ATP5H|ATPQ
Coordinate chr17:75038863-75046969
Strand -
Gene summary Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. It is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, which comprises the proton channel. The F1 complex consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled in a ratio of 3 alpha, 3 beta, and a single representative of the other 3. The Fo seems to have nine subunits (a, b, c, d, e, f, g, F6 and 8). This gene encodes the d subunit of the Fo complex. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. In addition, three pseudogenes are located on chromosomes 9, 12 and 15. [provided by RefSeq, Jun 2010]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes ATP5PDP4
Bonobo Pan paniscus ATP5PDP4
Gorilla Gorilla gorilla ATP5PDP4
Orangutan Pongo abelii ATP5PDP4
Gibbon Nomascus leucogenys ATP5PDP3
Green monkey Chlorocebus sabaeus ATP5HP8
Crab-eating macaque Macaca fascicularis ATP5HP3
Rhesus Macaca mulatta ATP5PDP3
Baboon Papio anubis ATP5PDP4
Golden snub-nosed monkey Rhinopithecus roxellana ATP5PDP1
Marmoset Callithrix jacchus ATP5PDP12
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

The Genotype-Tissue Expression project - (GTEx)

Adipose SubcutaneousMuscle SkeletalArtery TibialArtery CoronaryHeart Atrial AppendageAdipose VisceralUterusVaginaBreast Mammary TissueSkin Not Sun ExposedMinor Salivary GlandBrain CortexAdrenal GlandThyroidLungSpleenPancreasEsophagus MuscularisEsophagus MucosaEsophagus Gastroesophageal JunctionStomachColon SigmoidSmall Intestine Terminal IleumColon TransverseProstateTestisNerve TibialSkin Sun ExposedHeart Left VentricleBrain CerebellumWhole BloodArtery AortaPituitaryBrain Frontal CortexBrain CaudateBrain Nucleus AccumbensBrain PutamenBrain HypothalamusBrain Spinal CordBrain HippocampusBrain Anterior Cingulate CortexOvaryBrain Cerebellar HemisphereLiverBrain Substantia NigraKidney CortexBrain AmygdalaCervix EctocervixFallopian TubeCervix EndocervixBladderKidney Medulla00.050.10.150.2
log10(TPM+1)

Related Sequence

>ATP5PDP1
TGGGCTGCCATGGTCAGTGAAGTATACCAAGATGGCTGGGTGAAAACTTGCTCTAAAAACCATTGACTGGGTAGCTTTTGCAGAGATGATACCCCAAAACCAAAAGGCCATTGCTAATTATCTGAAATCCTGGAATGAGACCCTCACCTCCAGGCTGGCTACTTTACCTGAGAATCCACCAGCTATTGACTGGACTTACTACAAGGCCAATGTGGCCAAGGCAGGCTTGGTGGATGACTTTGAGAAGAAGTTTAATGTCCTGAAGCTTCCTGTACCAGAGGATAAATATACTGCCCAGGTGGATGCTGAAGAAAAAGAAGATGGGAAAACTTGTGCTGAGTGGGTGTCTCTCTCAAAGGCCAGGTTGGAGAATATGAGAAACAGCTGGAGAAGATGAGGAACTTAATACCATTTGATCAGATGACCATTGACGACTTGAACGAAGCTTTCCCGGAAACCAAATTAGACAAGAAAAAGTATCGCTATTGGTCTCACCAACCAATCAAGAATTTATAAAATTAAGTCCAGGAAGAAGCCCTGGCCCTTATAGTACACATTCTGGACATTAAAAATAAA
>NM_006356.3
CCGTTACTTGCTGCGGAGGACCGTGGGCAGCCAGGGTCGGTGAAGGATCCCAAAATGGCTGGGCGAAAACTTGCTCTAAAAACCATTGACTGGGTAGCTTTTGCAGAGATCATACCCCAGAACCAAAAGGCCATTGCTAGTTCCCTGAAATCCTGGAATGAGACCCTCACCTCCAGGTTGGCTGCTTTACCTGAGAATCCACCAGCTATCGACTGGGCTTACTACAAGGCCAATGTGGCCAAGGCTGGCTTGGTGGATGACTTTGAGAAGAAGTTTAATGCGCTGAAGGTTCCCGTGCCAGAGGATAAATATACTGCCCAGGTGGATGCCGAAGAAAAAGAAGATGTGAAATCTTGTGCTGAGTGGGTGTCTCTCTCAAAGGCCAGGATTGTAGAATATGAGAAAGAGATGGAGAAGATGAAGAACTTAATTCCATTTGATCAGATGACCATTGAGGACTTGAATGAAGCTTTCCCAGAAACCAAATTAGACAAGAAAAAGTATCCCTATTGGCCTCACCAACCAATTGAGAATTTATAAAATTGAGTCCAGGAGGAAGCTCTGGCCCTTGTATTACACATTCTGGACATTAAAAATAATAATTATACA

Publications

PMID - Link Title
No publications available for this retrocopy