Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name RPS13P9
Plot displaying the genomic locations of a retrocopy (in chr15) and its respective parental gene (in chr11). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr15:57555904-57556400  UCSC
Coordinates (T2T) chr15:55358740-55359236  UCSC
Coordinates (hg19) chr15:57848102-57848598  UCSC
Strand -
Parental Sequence NM_001017.3
Parental seq. overlap 452 bp
Parental seq. overlap (%) 85.8%
Genomic Region Intergenic
Retrocopy Summary RPS13P9, located on chr15:57555904-57556400, is a retrocopy of the parental gene RPS13. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name RPS13
Full Name ribosomal protein S13
Also known as S13
Coordinate chr11:17074388-17077667
Strand -
Gene summary Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S15P family of ribosomal proteins. It is located in the cytoplasm. The protein has been shown to bind to the 5.8S rRNA in rat. The gene product of the E. coli ortholog (ribosomal protein S15) functions at early steps in ribosome assembly. This gene is co-transcribed with two U14 small nucleolar RNA genes, which are located in its third and fifth introns. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes RPS13P8
Bonobo Pan paniscus RPS13P8
Gorilla Gorilla gorilla RPS13P8
Orangutan Pongo abelii RPS13P7
Gibbon Nomascus leucogenys RPS13P2
Green monkey Chlorocebus sabaeus RPS13P7
Crab-eating macaque Macaca fascicularis RPS13P4
Rhesus Macaca mulatta RPS13P4
Baboon Papio anubis RPS13P4
Golden snub-nosed monkey Rhinopithecus roxellana RPS13P5
Marmoset Callithrix jacchus RPS13P6
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>RPS13P9
TGCCTGACTGCCGCCGTCACGGGTCACATTCATGTGCCCGGGAAGGGCCTGTCCCAGTCGGCTTTGCTCTATCACCACAGCGTCCCCACTTGGCTGAAGTTGACATCTGACAATGTGAAGGAGCAGATTTACAAACTGACCAAGAAGGGCCTGACTCCTCCACAAATCGGTGTGATCCTGAGAGACTGACATGGTGCTGCAAAAGTGCGTTTTGTGACAGGCATAAGAATTCTTAAGTCTAAGGGACTTGCTCCTGATCTCCCTGAAGATCTCTACCACTTAATTAAGAAAGCAGTCGCTGTTCAAAAGCATCTTGAGAGGAGCAGAAAAGACAAGGATGCTAAATTCCTTCTGATTCTGATAGAGAGCCGGATTCACCGTCTGGCTCGATATTATAAAACCAAGCGAGTCCTCCCTCCCAGCTGGAAATATGAACCATCTACAGCTTCGCCCTGGTTGCATAAATTTGTCTATGTACTCAAGCAATAAAGTGATTA
>NM_001017.3
CCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTGTCCCAGTCGGCTTTACCCTATCGACGCAGCGTCCCCACTTGGTTGAAGTTGACATCTGACGACGTGAAGGAGCAGATTTACAAACTGGCCAAGAAGGGCCTTACTCCTTCACAGATCGGTGTAATCCTGAGAGATTCACATGGTGTTGCACAAGTACGTTTTGTGACAGGCAATAAAATTTTAAGAATTCTTAAGTCTAAGGGACTTGCTCCTGATCTTCCTGAAGATCTCTACCATTTAATTAAGAAAGCAGTTGCTGTTCGAAAGCATCTTGAGAGGAACAGAAAGGATAAGGATGCTAAATTCCGTCTGATTCTAATAGAGAGCCGGATTCACCGTTTGGCTCGATATTATAAGACCAAGCGAGTCCTCCCTCCCAATTGGAAATATGAATCATCTACAGCCTCTGCCCTGGTCGCATAAATTTGTCTGTGTACTCAAGCAATAAAATGATTGTTTAACTAAAAG

Publications

PMID - Link Title