Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name RPS17P24
Plot displaying the genomic locations of a retrocopy (in chr15) and its respective parental gene (in chr15). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr15:75023036-75023305  UCSC
Coordinates (T2T) chr15:72893024-72893293  UCSC
Coordinates (hg19) chr15:75315377-75315646  UCSC
Strand +
Parental Sequence NM_001021.6
Parental seq. overlap 237 bp
Parental seq. overlap (%) 47.8%
Genomic Region Intergenic
Retrocopy Summary RPS17P24, located on chr15:75023036-75023305, is a retrocopy of the parental gene RPS17. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name RPS17
Full Name ribosomal protein S17
Also known as DBA4|RPS17L|RPS17L1|RPS17L2|S17
Coordinate chr15:82536750-82540457
Strand -
Gene summary Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of four RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S17E family of ribosomal proteins and is located in the cytoplasm. Mutations in this gene cause Diamond-Blackfan anemia 4. Alternative splicing of this gene results in multiple transcript variants. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Apr 2014]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes LOC112207979P15
Bonobo Pan paniscus RPS17P16
Gorilla Gorilla gorilla RPS17P17
Orangutan Pongo abelii RPS17P19
Gibbon Nomascus leucogenys RPS17P6
Green monkey Chlorocebus sabaeus RPS17P20
Crab-eating macaque Macaca fascicularis RPS17P11
Rhesus Macaca mulatta RPS17P11
Baboon Papio anubis LOC101007228P11
Golden snub-nosed monkey Rhinopithecus roxellana RPS17P12
Marmoset Callithrix jacchus RPS17P13
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>RPS17P24
TCAGTGAGAGGTATCTGCATCAAGTTGCAGGAGGAGAAGAGAGAAAGGAGAGATAATCATGTTCCTGAGGTCTCAGCCCTGGATCAGGAAATCATTGAAGTATTAACATATCCTGACATTAAGGAAATGCTGATGTTTTTGGACTTTGGCAGTCTGTCCAACCTGCAGGTCACTCAGCCAACAGTGGGGATGAATTTCAAAACGCCACGTGGAAGCTGTTTGAATCTTTTTGAGATACTGTAATATTTTCAATAAACCTGGGACAACAGC
>NM_001021.6
GTTTCCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGCGGCCCGGGTCATCATAGAAAAGTACTACACGCGCCTGGGCAACGACTTCCACACGAACAAGCGCGTGTGCGAGGAGATCGCCATTATCCCCAGCAAAAAGCTCCGCAACAAGATAGCAGGTTATGTCACGCATCTGATGAAGCGAATTCAGAGAGGCCCAGTAAGAGGTATCTCCATCAAGCTGCAGGAGGAGGAGAGAGAAAGGAGAGACAATTATGTTCCTGAGGTCTCAGCCTTGGATCAGGAGATTATTGAAGTAGATCCTGACACTAAGGAAATGCTGAAGCTTTTGGACTTCGGCAGTCTGTCCAACCTTCAGGTCACTCAGCCTACAGTTGGGATGAATTTCAAAACGCCTCGGGGACCTGTTTGAATTTTTTCTGTAGTGCTGTATTATTTTCAATAAATCTGGGACAACAGCCTT

Publications

PMID - Link Title