Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name RPL39P33
Plot displaying the genomic locations of a retrocopy (in chr17) and its respective parental gene (in chrX). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr17:56572994-56573276  UCSC
Coordinates (T2T) chr17:57449121-57449403  UCSC
Coordinates (hg19) chr17:54650355-54650637  UCSC
Strand +
Parental Sequence NM_001000.4
Parental seq. overlap 254 bp
Parental seq. overlap (%) 65.1%
Genomic Region Intergenic
Retrocopy Summary RPL39P33, located on chr17:56572994-56573276, is a retrocopy of the parental gene RPL39. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name RPL39
Full Name ribosomal protein L39
Also known as L39|RPL39P42|RPL39_23_1806
Coordinate chrX:119786504-119791630
Strand -
Gene summary Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the S39E family of ribosomal proteins. It is located in the cytoplasm. In rat, the protein is the smallest, and one of the most basic, proteins of the ribosome. This gene is co-transcribed with the U69 small nucleolar RNA gene, which is located in its second intron. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes RPL39P40
Bonobo Pan paniscus RPL39P39
Gorilla Gorilla gorilla RPL39P17
Orangutan Pongo abelii RPL39P38
Gibbon Nomascus leucogenys RPL39P30
Green monkey Chlorocebus sabaeus RPL39P33
Crab-eating macaque Macaca fascicularis RPL39P46
Rhesus Macaca mulatta RPL39P44
Baboon Papio anubis RPL39P50
Golden snub-nosed monkey Rhinopithecus roxellana RPL39P47
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>RPL39P33
CTCCTTTCTCCACCATCGTGGTATATGCTTGACTCCGCTTCTCATCAAGTCTTCTCACAAGACTTTCAGGACTAAATGTTTCCTGGCCAAGAAACAAAAGCAGAATCGTCTCATTCTCCAGTGGATTTGGATGAAAACTGGTAATAAAATCAGATACAACTCCAAAAGGAGACATTGGAGAAGAAGGAAGCTGGGTCTATAAGGAATTGCACATGAGATGCCACACATATTTATGCTGTGTCAAAGTCACTACCATCTTATCATATCAAGCTGAAAATGTCAC
>NM_001000.4
CCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCACAAGACTTTCAGGATTAAGCGATTCCTGGCCAAGAAACAAAAGCAAAATCGTCCCATTCCCCAGTGGATTCGGATGAAAACTGGAAATAAAATCAGGTACAACTCCAAAAGGAGACATTGGAGAAGAACCAAGCTGGGTCTATAAGGAATTGCACATGAGATGGCACACATATTTATGCTGTCTGAAGGTCACGATCATGTTACCATATCAAGCTGAAAATGTCACCACTATCTGGAGATTTCGACGTGTTTTCCTCTCTGAATCTGTTATGAACACGTTGGTTGGCTGGATTCAGTAATAAATATGTAAGGCCTTTCTTTTTAA

Publications

PMID - Link Title