Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Advanced Search

Summary

Retrocopy Name RPL12P3
Plot displaying the genomic locations of a retrocopy (in chr20) and its respective parental gene (in chr9). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr20:33272281-33272652  UCSC
Coordinates (T2T) chr20:34999479-34999850  UCSC
Coordinates (hg19) chr20:31860087-31860458  UCSC
Strand -
Parental Sequence NM_000976.4
Parental seq. overlap 301 bp
Parental seq. overlap (%) 47%
Genomic Region Intergenic
Retrocopy Summary RPL12P3, located on chr20:33272281-33272652, is a retrocopy of the parental gene RPL12. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name RPL12
Full Name ribosomal protein L12
Also known as L12
Coordinate chr9:127447674-127451406
Strand -
Gene summary Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L11P family of ribosomal proteins. It is located in the cytoplasm. The protein binds directly to the 26S rRNA. This gene is co-transcribed with the U65 snoRNA, which is located in its fourth intron. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes RPL12P42
Gorilla Gorilla gorilla RPL12P39
Golden snub-nosed monkey Rhinopithecus roxellana RPL12P31
Dolphin Tursiops truncatus RPL12P18
Horse Equus caballus RPL12P17
Velvety free-tailed bat Molossus molossus RPL12P15
Egyptian rousette Rousettus aegyptiacus RPL12P15
Bonobo Pan paniscus Without Homology
Orangutan Pongo abelii Without Homology
Gibbon Nomascus leucogenys Without Homology
Green monkey Chlorocebus sabaeus Without Homology
Crab-eating macaque Macaca fascicularis Without Homology
Rhesus Macaca mulatta Without Homology
Baboon Papio anubis Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>RPL12P3
GTTCAACCCCAAGGAAATCAAAGTCTTGTACCTGATGTGCACTGGTGGGGAAGTTGTGCCACATCTGCCCTGGCCACCAAGATGGGCACCCTGGGGCTGTCTCCTAAAAAATGGTTGGTGATGATATCACCAAGGCAATTGGTGGGTTTAAGGAAGGGTTTAAGGATGACAGGGAAACGGATCATTTGGGACAGACAGGCCCAGACTGAAGCAGTACCTTCTGCCTCTGCCTTGACCATCAAAGCTGTCAAAGGACCACTCAGACAGAGAAAAGCAGAAGCACATTAAGCACAGTGGACATGTAACTGTTGAAGAGATCGTCAACATTGCCGACATAGGCGGGAAAATCGTTAGCCAGAGAACTCTCTGGAG
>NM_000976.4
CCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCCGGGTTCATCCGACACCAGCCGCCTCCACCATGCCGCCGAAGTTCGACCCCAACGAGATCAAAGTCGTATACCTGAGGTGCACCGGAGGTGAAGTCGGTGCCACTTCTGCCCTGGCCCCCAAGATCGGCCCCCTGGGTCTGTCTCCAAAAAAAGTTGGTGATGACATTGCCAAGGCAACGGGTGACTGGAAGGGCCTGAGGATTACAGTGAAACTGACCATTCAGAACAGACAGGCCCAGATTGAGGTGGTGCCTTCTGCCTCTGCCCTGATCATCAAAGCCCTCAAGGAACCACCAAGAGACAGAAAGAAACAGAAAAACATTAAACACAGTGGGAATATCACTTTTGATGAGATTGTCAACATTGCTCGACAGATGCGGCACCGATCCTTAGCCAGAGAACTCTCTGGAACCATTAAAGAGATCCTGGGGACTGCCCAGTCAGTGGGCTGTAATGTTGATGGCCGCCATCCTCATGACATCATCGATGACATCAACAGTGGTGCTGTGGAATGCCCAGCCAGTTAAGCACAAAGGAAAACATTTCAATAAAGGATCATTTGACAACTGGTGGA

Publications

PMID - Link Title