Retrocopy Name | COX6CP29 |
|
Species | Homo sapiens | |
Coordinates (hg38) | chr20:33629190-33629331 UCSC | |
Coordinates (T2T) | chr20:35355724-35355865 UCSC | |
Coordinates (hg19) | chr20:32216996-32217137 UCSC | |
Strand | - | |
Parental Sequence | NM_004374.4 | |
Parental seq. overlap | 122 bp | |
Parental seq. overlap (%) | 16.4% | |
Genomic Region |
Intragenic (CBFA2T2) |
|
Retrocopy Summary | COX6CP29, located on chr20:33629190-33629331, is a retrocopy of the parental gene COX6C. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
Gene Name | COX6C |
Full Name | cytochrome c oxidase subunit 6C |
Also known as | - |
Coordinate | chr8:99877865-99893707 |
Strand | - |
Gene summary | Cytochrome c oxidase, the terminal enzyme of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. It is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, and the nuclear-encoded subunits may be involved in the regulation and assembly of the complex. This nuclear gene encodes subunit VIc, which has 77% amino acid sequence identity with mouse subunit VIc. This gene is up-regulated in prostate cancer cells. A pseudogene has been found on chromosomes 16p12. [provided by RefSeq, Jul 2010] |
Species | Scientific Name | Retrocopy | |
![]() |
Bonobo | Pan paniscus | LOC100994763P23 |
![]() |
Orangutan | Pongo abelii | COX6CP24 |
![]() |
Gibbon | Nomascus leucogenys | LOC100588890P15 |
![]() |
Golden snub-nosed monkey | Rhinopithecus roxellana | LOC104679876P17 |
![]() |
Chimpanzee | Pan troglodytes | Without Homology |
![]() |
Gorilla | Gorilla gorilla | Without Homology |
![]() |
Green monkey | Chlorocebus sabaeus | Without Homology |
![]() |
Crab-eating macaque | Macaca fascicularis | Without Homology |
![]() |
Rhesus | Macaca mulatta | Without Homology |
![]() |
Baboon | Papio anubis | Without Homology |
![]() |
Marmoset | Callithrix jacchus | Without Homology |
![]() |
Mouse lemur | Microcebus murinus | Without Homology |
![]() |
Mouse | Mus musculus | Without Homology |
![]() |
Rat | Rattus norvegicus | Without Homology |
![]() |
Chinese hamster | Cricetulus griseus | Without Homology |
![]() |
Rabbit | Oryctolagus cuniculus | Without Homology |
![]() |
Pig | Sus scrofa | Without Homology |
![]() |
Cow | Bos taurus | Without Homology |
![]() |
Sheep | Ovis aries | Without Homology |
![]() |
Dolphin | Tursiops truncatus | Without Homology |
![]() |
Horse | Equus caballus | Without Homology |
![]() |
Dog | Canis familiaris | Without Homology |
![]() |
Panda | Ailuropoda melanoleuca | Without Homology |
![]() |
Cat | Felis catus | Without Homology |
![]() |
Pale spear-nosed bat | Phyllostomus discolor | Without Homology |
![]() |
Velvety free-tailed bat | Molossus molossus | Without Homology |
![]() |
Greater mouse-eared bat | Myotis myotis | Without Homology |
![]() |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
![]() |
Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology |
![]() |
Egyptian rousette | Rousettus aegyptiacus | Without Homology |
![]() |
Sloth | Choloepus didactylus | Without Homology |
![]() |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
![]() |
Opossum | Monodelphis domestica | Without Homology |
![]() |
Platypus | Ornithorhynchus anatinus | Without Homology |
![]() |
Chicken | Gallus gallus | Without Homology |
![]() |
Turkey | Meleagris gallopavo | Without Homology |
![]() |
Zebra Finch | Taeniopygia guttata | Without Homology |
![]() |
Budgerigar | Melopsittacus undulatus | Without Homology |
![]() |
Painted Turtle | Chrysemys picta | Without Homology |
![]() |
Lizard | Anolis Carolinensis | Without Homology |
![]() |
Frog | Xenopus tropicalis | Without Homology |
![]() |
Zebrafish | Danio rerio | Without Homology |
![]() |
Drosophila | Drosophila melanogaster | Without Homology |
>COX6CP29 |
ATTTTGATGAGATGAGGAAGGCTGCTATCTTTCAGAGTGCAAAATAATTTTGGAATATAAACAATTTTGGGGGGTTGAATTACCTAGAAGTTTGTTACTGACCTGTGTTCTAAAACTACGAAACATGAGTATGTGGGCTAAA |
>NM_004374.4 |
ATTCTGCGCCTGCGCGCGGCTACAGCACGGTTCGTTTTTCCTTTAGTCAGGAAGGACGTTGGTGTTGAGgttagcaTACGTATCAAGGACAGTAACTACCATGGCTCCCGAAGTTTTGCCAAAACCTCGGATGCGTGGCCTTCTGGCCAGGCGTCTGCGAAATCATATGGCTGTAGCATTCGTGCTATCCCTGGGGGTTGCAGCTTTGTATAAGTTTCGTGTGGCTGATCAAAGAAAGAAGGCATACGCAGATTTCTACAGAAACTACGATGTCATGAAAGATTTTGAGGAGATGAGGAAGGCTGGTATCTTTCAGAGTGTAAAGTAATCTTGGAATATAAAGAATTTCTTCAGGTTGAATTACCTAGAAGTTTGTCACTGACTTGTGTTCCTGAACTATGACACATGAATATGTGGGCTAAGAAATAGTTCCTCTTGATAAATAAACAATTAACAAATACTTTGGACAGTAAGTCTTTCTCAGTTCTTAATGATAATGCAGGGCACTTACTAGCATAAGAATTGGTTTGGGATTTAACTGTTTATGAAGCTAACTTGATTTCCGTGTTTTGTTAAAATTTCATTGTTCTAGCACATCTTTAACTGTGATAGTTTGTCCGTTTCATTGCAGTTACTTGGTCTTGGGCTATGGATTAAAAAGTGTTCTTCATGAGCCTGTAAGACTACTGTACTGTGGGCTCTAAGAAGAGATAGAATCCTAATAAAATCTATCCTTGGCCTTCA |
PMID - Link | Title |
---|