Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name RPS3AP63
Plot displaying the genomic locations of a retrocopy (in chr20) and its respective parental gene (in chr4). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr20:47630763-47630905  UCSC
Coordinates (T2T) chr20:49369166-49369308  UCSC
Coordinates (hg19) chr20:46259507-46259649  UCSC
Strand -
Parental Sequence NM_001006.5
Parental seq. overlap 123 bp
Parental seq. overlap (%) 14.1%
Genomic Region Intragenic (NCOA3)
Retrocopy Summary RPS3AP63, located on chr20:47630763-47630905, is a retrocopy of the parental gene RPS3A. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name RPS3A
Full Name ribosomal protein S3A
Also known as FTE1|MFTL|S3A
Coordinate chr4:151099628-151104642
Strand +
Gene summary Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S3AE family of ribosomal proteins. It is located in the cytoplasm. Disruption of the gene encoding rat ribosomal protein S3a, also named v-fos transformation effector protein, in v-fos-transformed rat cells results in reversion of the transformed phenotype. This gene is co-transcribed with the U73A and U73B small nucleolar RNA genes, which are located in its fourth and third introns, respectively. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, May 2012]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes LOC461536P44
Bonobo Pan paniscus LOC100975318P43
Gorilla Gorilla gorilla LOC101144197P42
Orangutan Pongo abelii RPS3AP37
Green monkey Chlorocebus sabaeus LOC103236378P2
Crab-eating macaque Macaca fascicularis RPS3AP30
Rhesus Macaca mulatta LOC703455P29
Baboon Papio anubis LOC101003493P41
Mouse lemur Microcebus murinus RPS3AP16
Horse Equus caballus RPS3AP7
Dog Canis familiaris RPS3AP21
Greater horseshoe bat Rhinolophus ferrumequinum RPS3AP69
Gibbon Nomascus leucogenys Without Homology
Golden snub-nosed monkey Rhinopithecus roxellana Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>RPS3AP63
CTCTTATGCTCAGCACCAACAGATATGCCAAATCCCAATGATGATGGAAGTTGTGACCCAAAAGGTACAGACAAATAACTTGAAAGAAGTGGGCAATAAACTGACTCCAGACAAATTAGGAAAGACATTGAAAAGGCTTGCCC
>NM_001006.5
CCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGGCGGCAAAAAGGGAGCCAAGAAGAAAGTGGTTGATCCATTTTCTAAGAAAGATTGGTATGATGTGAAAGCACCTGCTATGTTCAATATAAGAAATATTGGAAAGACGCTCGTCACCAGGACCCAAGGAACCAAAATTGCATCTGATGGTCTCAAGGGTCGTGTGTTTGAAGTGAGTCTTGCTGATTTGCAGAATGATGAAGTTGCATTTAGAAAATTCAAGCTGATTACTGAAGATGTTCAGGGTAAAAACTGCCTGACTAACTTCCATGGCATGGATCTTACCCGTGACAAAATGTGTTCCATGGTCAAAAAATGGCAGACAATGATTGAAGCTCACGTTGATGTCAAGACTACCGATGGTTACTTGCTTCGTCTGTTCTGTGTTGGTTTTACTAAAAAACGCAACAATCAGATACGGAAGACCTCTTATGCTCAGCACCAACAGGTCCGCCAAATCCGGAAGAAGATGATGGAAATCATGACCCGAGAGGTGCAGACAAATGACTTGAAAGAAGTGGTCAATAAATTGATTCCAGACAGCATTGGAAAAGACATAGAAAAGGCTTGCCAATCTATTTATCCTCTCCATGATGTCTTCGTTAGAAAAGTAAAAATGCTGAAGAAGCCCAAGTTTGAATTGGGAAAGCTCATGGAGCTTCATGGTGAAGGCAGTAGTTCTGGAAAAGCCACTGGGGACGAGACAGGTGCTAAAGTTGAACGAGCTGATGGATATGAACCACCAGTCCAAGAATCTGTTTAAAGTTCAGACTTCAAATAGTGGCAAATAAAAAGTGCTATTTGTGATGGTT

Publications

PMID - Link Title