Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name MRPS18BP2
Wait
Plot displaying the genomic locations of a retrocopy (in chr2) and its respective parental gene (in chr6). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr2:139668547-139669331  UCSC
Coordinates (T2T) chr2:140114241-140115025  UCSC
Coordinates (hg19) chr2:140426116-140426900  UCSC
Strand +
Parental Sequence NM_014046.4_7
Parental seq. overlap 674 bp
Parental seq. overlap (%) 48%
Genomic Region Intergenic
Retrocopy Summary MRPS18BP2, located on chr2:139668547-139669331, is a retrocopy of the parental gene MRPS18B. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name MRPS18B
Full Name mitochondrial ribosomal protein S18B
Also known as C6orf14|HSPC183|HumanS18a|MRP-S18-2|MRPS18-2|PTD017|S18amt
Coordinate chr6:30617320-30626393
Strand +
Gene summary Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that belongs to the ribosomal protein S18P family. The encoded protein is one of three that has significant sequence similarity to bacterial S18 proteins. The primary sequences of the three human mitochondrial S18 proteins are no more closely related to each other than they are to the prokaryotic S18 proteins. Pseudogenes corresponding to this gene are found on chromosomes 1q and 2q. [provided by RefSeq, Jul 2008]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes MRPS18BP1
Bonobo Pan paniscus MRPS18BP1
Gorilla Gorilla gorilla MRPS18BP1
Orangutan Pongo abelii MRPS18BP2
Gibbon Nomascus leucogenys MRPS18BP2
Green monkey Chlorocebus sabaeus MRPS18BP2
Crab-eating macaque Macaca fascicularis MRPS18BP2
Rhesus Macaca mulatta MRPS18BP2
Baboon Papio anubis MRPS18BP2
Golden snub-nosed monkey Rhinopithecus roxellana MRPS18BP2
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

The Genotype-Tissue Expression project - (GTEx)

Adipose SubcutaneousMuscle SkeletalArtery TibialArtery CoronaryHeart Atrial AppendageAdipose VisceralUterusVaginaBreast Mammary TissueSkin Not Sun ExposedMinor Salivary GlandBrain CortexAdrenal GlandThyroidLungSpleenPancreasEsophagus MuscularisEsophagus MucosaEsophagus Gastroesophageal JunctionStomachColon SigmoidSmall Intestine Terminal IleumColon TransverseProstateTestisNerve TibialSkin Sun ExposedHeart Left VentricleBrain CerebellumWhole BloodArtery AortaPituitaryBrain Frontal CortexBrain CaudateBrain Nucleus AccumbensBrain PutamenBrain HypothalamusBrain Spinal CordBrain HippocampusBrain Anterior Cingulate CortexOvaryBrain Cerebellar HemisphereLiverBrain Substantia NigraKidney CortexBrain AmygdalaCervix EctocervixFallopian TubeCervix EndocervixBladderKidney Medulla00.050.10.15
log10(TPM+1)

Related Sequence

>MRPS18BP2
ATATTAAACACCTACTAAGGCAGCTTCCTATCCTTTCTCTCTTCTGAAGTACAAATGGAGTTCAGGTTCCCCTCCAGACTCTTTCACCAAAGCTCCTTCTGAGAAAGATTCTTTGCCCCCAGTTCCCATTTCACTATATGAGAATGAACCCTGGAAATATCTGGAATCAGAAGAATACCAAGAACCATAGGGTTCTCATCCCAACTGGGTGGACTATTGCCACTACTACAAGGGTGATATACCCCCACAGCAGACTCAAAAGACATGTATGCATAGGAAAACAGTCGCTGGGAATCCCTGCCCCATCTGCCAAGGTCACAAGTTGCATGTTGACTTTAGGAATGTTAAGCTCTTGGAACAGTTTGTCAGTGCCCACACGGGTATTATCTTCCACGCTCCATACACAGGAGTCTGTATGAAGCAGCACAAGATGTTGACCCATGCCATCCAGAAAGCCAGGGATCATGGTCTCCTCAGTTACCACATCTCCCAAGTTGAACCCCGGGACCTTGATTTTAGTGCCTCTCATGGAGCTATGAGTACTTCTCTGCCAGTCCCCACCCTCGTCTCAGGTGAACCCTGGTACCTATGGTACAGCTGGAAACAGCCATCAGAGAAAGAACTGTCTCACCTTTGCCAGCTCTATCAGGATTATCTCTAAGAAGAGAGTGGCCCCCGCACCTGAGTCAATGCCCAAGATGCTTCCCACAACACCAGTGGAAGCCTCCTTCACTGAAGAGACAGGCCCCTAGAGTGCTCTGGAGTCATAGACTGGGAAGAGA
>NM_014046.4_7
AATTCCTGTCCTGGGCGTACGTCAAGATGGCGGCGTCTGTATTAAACACCGTGCTGAGGCGGCTTCCTATGCTATCTCTCTTCCGAGGTTCTCACAGAGTTCAGGTTCCCCTCCAGACTCTTTGCACCAAAGCTCCCTCTGAGGAAGATTCTTTGTCCTCAGTTCCCATTTCTCCTTATAAGGATGAGCCCTGGAAATATCTGGAATCAGAAGAATACCAGGAGCGATATGGTTCTCGCCCCGTCTGGGCTGACTACCGCCGCAACCACAAGGGTGGTGTACCCCCACAGCGGACTCGGAAGACATGTATTCGTCGGAATAAAGTTGTTGGGAATCCCTGCCCCATCTGTCGAGATCACAAGTTGCATGTTGACTTTAGGAACGTGAAGCTCTTGGAGCAATTTGTCTGCGCCCACACGGGTATCATCTTCTATGCTCCATACACAGGAGTCTGTGTGAAGCAGCACAAGCGGTTGACCCAGGCCATCCAGAAAGCCAGGGATCATGGTCTCCTCATTTACCACATCCCCCAGGTTGAACCACGGGACCTTGACTTCAGTACCTCTCATGGGGCTGTGAGTGCTACTCCGCCAGCCCCCACCCTGGTCTCAGGTGACCCCTGGTACCCATGGTACAACTGGAAACAGCCACCGGAGAGAGAACTGTCTCGCCTTCGCCGGCTTTACCAGGGTCATCTCCAAGAAGAGAGTGGCCCCCCACCTGAGTCAATGCCCAAGATGCCCCCTAGAACACCAGCGGAAGCCTCCTCCACTGGGCAGACAGGCCCTCAGAGTGCTCTGTAGGAGCTGTAGACTGGGAAGAGAggccaggcgtggtggctcactcctgtaatcccagcactttgggaagccaaggtgggctgatcacttgatcccaggagtttgagaccagcctgggcaccatggtgaaacctcgtctttaccaaaaaatacaaaaattagctgggtgtggtggtgcacacctgtagtctcaactattggggaggctaaggtaggatcacttgatcccaggaggcggaggttgcagtgagttgcagtcacacccctgcactccagcctgggtgacagctagaccctgtctcaaaaaaaaaaaaaaaGACTGGGAAGAGAGCTAGAGGGACTAGGAGATAATGTGTATGTAGGTTTATGTGATGGGATATCACCCTGAAGAGTTGTGTCTTTTGTGGCCAGTGACAAATCCAGGAAATGAATGTTGCTGATAGGGATAAATCTTGAGGCTGAGGGCGGGTGGTACAGATGTGTATGGGAAACCCCAACCCCTATATATTGTAAATAGATGGGCTGGGCTAAACATTGTTGCCGTTTCATACTTCTACCAACTCAGCTTTTACACAATAAAGCTCTACTGTCTCTGGTT

Publications

PMID - Link Title
No publications available for this retrocopy