Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Advanced Search

Summary

Retrocopy Name ATP5MC2P3
Plot displaying the genomic locations of a retrocopy (in chr2) and its respective parental gene (in chr12). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr2:197263056-197263679  UCSC
Coordinates (T2T) chr2:197746788-197747412  UCSC
Coordinates (hg19) chr2:198127780-198128403  UCSC
Strand +
Parental Sequence NM_005176.7
Parental seq. overlap 557 bp
Parental seq. overlap (%) 87.6%
Genomic Region Intragenic (ANKRD44)
Retrocopy Summary ATP5MC2P3, located on chr2:197263056-197263679, is a retrocopy of the parental gene ATP5MC2. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name ATP5MC2
Full Name ATP synthase membrane subunit c locus 2
Also known as ATP5A|ATP5G2
Coordinate chr12:53665166-53677546
Strand -
Gene summary This gene encodes a subunit of mitochondrial ATP synthase. Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. ATP synthase is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, comprising the proton channel. The catalytic portion of mitochondrial ATP synthase consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled with a stoichiometry of 3 alpha, 3 beta, and single representatives of the gamma, delta, and epsilon subunits. The proton channel likely has nine subunits (a, b, c, d, e, f, g, F6 and 8). There are three separate genes which encode subunit c of the proton channel and they specify precursors with different import sequences but identical mature proteins. The protein encoded by this gene is one of three precursors of subunit c. This gene has multiple pseudogenes. [provided by RefSeq, Jan 2018]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes ATP5MC2P2
Bonobo Pan paniscus ATP5MC2P2
Gorilla Gorilla gorilla ATP5MC2P2
Orangutan Pongo abelii ATP5MC2P2
Gibbon Nomascus leucogenys ATP5MC2P4
Green monkey Chlorocebus sabaeus ATP5G2P1
Crab-eating macaque Macaca fascicularis ATP5G2P4
Rhesus Macaca mulatta ATP5MC2P4
Baboon Papio anubis ATP5MC2P5
Golden snub-nosed monkey Rhinopithecus roxellana ATP5MC2P5
Marmoset Callithrix jacchus ATP5MC2P4
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>ATP5MC2P3
GTGTCTTCCCTGCACTGGGCCCAGCTCTCCTGCCACAGCCCCTCACCCCCTGAAAATGTACACCTGCTCCAAGTTCGTCTCCACTCCCTCCTTGGTCAAGAGCGCCTCACAGCTGCTAAGCCATCTGCTACCTGCAGTGGTGCTGAAATGACCAGAGACACTGACAGGTGAGAACCTCAGCAGCTTGGTAGTCTCACGTCCCCTTACCTCACTTGTCCCTGGCCGCAGCTTGGAAAGCAGCGCCATTTCAAGGGACATCGACACAACAGCCAAGTTCATTGGGGCTGGGGCGCCACAGTTGGGGTGGCGGGCTCTGGGGCTGGGATTGCGACTGTGTTTGGGAGCCTCATCATTGATTATGCCAGGAACCCTTCTCTGAAACAACAGCTCTTCTCCTACACCATTCTAGGCTTTACCCTCTAGGAAACCATGGGGCTCTTTTGCCTGATGGTGGCCTTTCTCATCCTCTTCCCCATGTGAAGCAGCTGTCTCCACCTCCCATATTTCTTTCTCCCATGTCTTGTCAGCCCTGTATGTTTCTTTTCCTGCACCTCCCCAGATGGCCTGGGGAACATGGTTGGCTCAGGGTTTGATAGAGGAAAGACAAATACTGTATTAATAAGA
>NM_005176.7
CCCCTCTCTGTCTTCTCTGCAGTGGGAGCAGCTCTCCTGCCACAGCTCCTCACCCCCTGAAAATGTTCGCCTGCTCCAAGTTTGTCTCCACTCCCTCCTTGGTCAAGAGCACCTCACAGCTGCTGAGCCGTCCGCTATCTGCAGTGGTGCTGAAACGACCGGAGATACTGACAGATGAGAGCCTCAGCAGCTTGGCAGTCTCATGTCCCCTTACCTCACTTGTCTCTAGCCGCAGCTTCCAAACCAGCGCCATTTCAAGGGACATCGACACAGCAGCCAAGTTCATtggagctggggctgccacagttggggtggctggttctggggctgggattggaactgtgtttgggAGCCTCATCATTGGTTATGCCAGGAACCCTTCTCTGAAGCAACAGCTCTTCTCCTACGCCATTCTGGGCTTTGCCCTCTCGGAGGCCATGGGGCTCTTTTGTCTGATGGTAGCCTTTCTCATCCTCTTTGCCATGTGAAGGAGCCGTCTCCACCTCCCATAGTTCTCCCGCGTCTGGTTGGCCCCGTGTGTTCCTTTTCCTATACCTCCCCAGGCAGCCTGGGGAACGTGGTTGGCTCAGGGTTTGACAGAGAAAAGACAAATAAATACTGTATTAATAAGA

Publications

PMID - Link Title