Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Advanced Search

Summary

Retrocopy Name ATP5PFP5
Plot displaying the genomic locations of a retrocopy (in chr22) and its respective parental gene (in chr21). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr22:22988206-22988684  UCSC
Coordinates (T2T) chr22:23411077-23411555  UCSC
Coordinates (hg19) chr22:23330381-23330859  UCSC
Strand +
Parental Sequence NM_001003703.2
Parental seq. overlap 440 bp
Parental seq. overlap (%) 82.4%
Genomic Region Intergenic
Retrocopy Summary ATP5PFP5, located on chr22:22988206-22988684, is a retrocopy of the parental gene ATP5PF. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name ATP5PF
Full Name ATP synthase peripheral stalk subunit F6
Also known as ATP5|ATP5A|ATP5J|ATPM|CF6|F6
Coordinate chr21:25724500-25735653
Strand -
Gene summary Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. It is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, which comprises the proton channel. The F1 complex consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled in a ratio of 3 alpha, 3 beta, and a single representative of the other 3. The Fo complex has nine subunits (a, b, c, d, e, f, g, F6 and 8). This gene encodes the F6 subunit of the Fo complex. The F6 subunit is required for F1 and Fo interactions. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. This gene has 1 or more pseudogenes. [provided by RefSeq, Feb 2016]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes ATP5PFP4
Gorilla Gorilla gorilla ATP5PFP4
Orangutan Pongo abelii ATP5PFP4
Bonobo Pan paniscus Without Homology
Gibbon Nomascus leucogenys Without Homology
Green monkey Chlorocebus sabaeus Without Homology
Crab-eating macaque Macaca fascicularis Without Homology
Rhesus Macaca mulatta Without Homology
Baboon Papio anubis Without Homology
Golden snub-nosed monkey Rhinopithecus roxellana Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>ATP5PFP5
TTGGTGGCGGTGGTGGCTTTGGCAGCTCAGGACCGAGTGCAAGTAACATAGAATCAGCATGACTCTTCAGAGGCTCTTCAGGTTCTCCTCTGTCATTCTGTCAGCAGTCTCAGTCCATTTGTGGAGGAACATCAGTGTTACAGCAGTGGCATTTAATAAGGAACTTGATCCTATACAGAAACTCTTGTGGACAAGATTAGAGAATACAAATCGAAGTGACAGACATCTGGAGGACCTGTTGATACTGGTCCAGAGTATCAGCAAGAGCTTGAGAGGGAGCTTTTTAAGTTCAAGCAAATGTTTGGTAAAACAGACATGAATACATTTCCCAACTTCAAATTTGAAGATCCCAAATCTGAAGTCATCGAAAAACCCCAGGTCTGAAGAAATAAAGTGAAATTAATCTGGTAATTTATCATGGGTCAATTGTACAACTAGTTAGAAGTTTCAGAATAAACATACATTTCATAACGGTCAAA
>NM_001003703.2
AGAGCGGAGGTGGTGGCGGCGGAGGCTTTGGCAGCTCGGGACTGAGTGCAAGAATCAGCATGATTCTTCAGAGGCTCTTCAGGTTCTCCTCTGTCATTCGGTCAGCCGTCTCAGTCCATTTGCGGAGGAACATTGGTGTTACAGCAGTGGCATTTAATAAGGAACTTGATCCTATACAGAAACTCTTTGTGGACAAGATTAGAGAATACAAATCTAAGCGACAGACATCTGGAGGACCTGTTGATGCTAGTTCAGAGTATCAGCAAGAGCTGGAGAGGGAGCTTTTTAAGCTCAAGCAAATGTTTGGTAATGCAGACATGAATACATTTCCCACCTTCAAATTTGAAGATCCCAAATTTGAAGTCATCGAAAAACCCCAGGCCTGAAGAAATAAAGTAAAATTAATCTGGTAATTTGTCACGGATTAGTTGTACAACTAGTTAGAAGTTTCAGAATAAACATGCATTTCATAACTGTCAAATGTTCTTTTAATTCTGAGTCCAAATAAATTATTTGGTGATGTTGA

Publications

PMID - Link Title