Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name RPS10P52
Plot displaying the genomic locations of a retrocopy (in chr22) and its respective parental gene (in chr6). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr22:23322491-23322927  UCSC
Coordinates (T2T) chr22:23745353-23745788  UCSC
Coordinates (hg19) chr22:23664678-23665114  UCSC
Strand -
Parental Sequence NM_001014.5
Parental seq. overlap 401 bp
Parental seq. overlap (%) 67.7%
Genomic Region Intergenic
Retrocopy Summary RPS10P52, located on chr22:23322491-23322927, is a retrocopy of the parental gene RPS10. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name RPS10
Full Name ribosomal protein S10
Also known as DBA9|S10
Coordinate chr6:34417454-34426069
Strand -
Gene summary Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S10E family of ribosomal proteins. It is located in the cytoplasm. Variable expression of this gene in colorectal cancers compared to adjacent normal tissues has been observed, although no correlation between the level of expression and the severity of the disease has been found. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Alternate splicing results in multiple transcript variants that encode the same protein. Naturally occurring read-through transcription occurs between this locus and the neighboring locus NUDT3 (nudix (nucleoside diphosphate linked moiety X)-type motif 3).[provided by RefSeq, Feb 2011]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes LOC104001113P30
Gorilla Gorilla gorilla LOC109025084P31
Baboon Papio anubis RPS10P27
Bonobo Pan paniscus Without Homology
Orangutan Pongo abelii Without Homology
Gibbon Nomascus leucogenys Without Homology
Green monkey Chlorocebus sabaeus Without Homology
Crab-eating macaque Macaca fascicularis Without Homology
Rhesus Macaca mulatta Without Homology
Golden snub-nosed monkey Rhinopithecus roxellana Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>RPS10P52
TGTGCCCAACCTTCATGTCATGAAGGCCATGCAGTCTTTCAAGTCCCGAGGCTACTACATGAAGGAACAGTTTGCCTGGAGTCATGTCTGCTGGTACCTTACCAATGAGGATATCCAGTATCTCCGTGATTACCTTCATCTGCCCCTGGAGATTGTGCCTGCCACCCTACGCCGCAGCCGTCCATGGACTGGCAGGCCTCAGTCTAAAGGTCTGGAGGGTGAGCGACCTGCAAGACTCAACGAGAGGGGAAGCCGACAGAGATACCTACAGAGGGAATGCTATGCCCCCTGGTGCCAACAAGAAAGCCGAGGCTGCGGCTGGGTCAGCAACCGAATTCCAGTTTAGAGGCAGATTTGGTCGTGGACGCCGTCAGCCACCTCAGTAAAATTGGAGAAGATTATTTTGCATTGAATAAACTTACAGCCAAAAAG
>NM_001014.5
CCTTTCCAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAAGAACCGGATTGCCATTTATGAACTCCTTTTTAAGGAGGGAGTCATGGTGGCCAAGAAGGATGTCCACATGCCTAAGCACCCGGAGCTGGCAGACAAGAATGTGCCCAACCTTCATGTCATGAAGGCCATGCAGTCTCTCAAGTCCCGAGGCTACGTGAAGGAACAGTTTGCCTGGAGACATTTCTACTGGTACCTTACCAATGAGGGTATCCAGTATCTCCGTGATTACCTTCATCTGCCCCCGGAGATTGTGCCTGCCACCCTACGCCGTAGCCGTCCAGAGACTGGCAGGCCTCGGCCTAAAGGTCTGGAGGGTGAGCGACCTGCGAGACTCACAAGAGGGGAAGCTGACAGAGATACCTACAGACGGAGTGCTGTGCCACCTGGTGCCGACAAGAAAGCCGAGGCTGGGGCTGGGTCAGCAACCGAATTCCAGTTTAGAGGCGGATTTGGTCGTGGACGTGGTCAGCCACCTCAGTAAAATTGGAGAGGATTCTTTTGCATTGAATAAACTTACAGCCAAAAAACCTTAA

Publications

PMID - Link Title