Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name RPS17P26
Wait
Plot displaying the genomic locations of a retrocopy (in chr22) and its respective parental gene (in chr15). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr22:32039464-32039944  UCSC
Coordinates (T2T) chr22:32503614-32504094  UCSC
Coordinates (hg19) chr22:32435451-32435931  UCSC
Strand +
Parental Sequence NM_001021.6
Parental seq. overlap 465 bp
Parental seq. overlap (%) 95.3%
Genomic Region Intergenic
Retrocopy Summary RPS17P26, located on chr22:32039464-32039944, is a retrocopy of the parental gene RPS17. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name RPS17
Full Name ribosomal protein S17
Also known as DBA4|RPS17L|RPS17L1|RPS17L2|S17
Coordinate chr15:82536750-82540457
Strand -
Gene summary Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of four RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S17E family of ribosomal proteins and is located in the cytoplasm. Mutations in this gene cause Diamond-Blackfan anemia 4. Alternative splicing of this gene results in multiple transcript variants. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Apr 2014]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes LOC112207979P17
Bonobo Pan paniscus RPS17P18
Gorilla Gorilla gorilla RPS17P19
Orangutan Pongo abelii RPS17P22
Gibbon Nomascus leucogenys RPS17P7
Green monkey Chlorocebus sabaeus Without Homology
Crab-eating macaque Macaca fascicularis Without Homology
Rhesus Macaca mulatta Without Homology
Baboon Papio anubis Without Homology
Golden snub-nosed monkey Rhinopithecus roxellana Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

The Genotype-Tissue Expression project - (GTEx)

Adipose SubcutaneousMuscle SkeletalArtery TibialArtery CoronaryHeart Atrial AppendageAdipose VisceralUterusVaginaBreast Mammary TissueSkin Not Sun ExposedMinor Salivary GlandBrain CortexAdrenal GlandThyroidLungSpleenPancreasEsophagus MuscularisEsophagus MucosaEsophagus Gastroesophageal JunctionStomachColon SigmoidSmall Intestine Terminal IleumColon TransverseProstateTestisNerve TibialSkin Sun ExposedHeart Left VentricleBrain CerebellumWhole BloodArtery AortaPituitaryBrain Frontal CortexBrain CaudateBrain Nucleus AccumbensBrain PutamenBrain HypothalamusBrain Spinal CordBrain HippocampusBrain Anterior Cingulate CortexOvaryBrain Cerebellar HemisphereLiverBrain Substantia NigraKidney CortexBrain AmygdalaCervix EctocervixFallopian TubeCervix EndocervixBladderKidney Medulla00.511.5
log10(TPM+1)

Massive Mining of Publicly Available RNA-seq Data from Human and Mouse - (ARCHS4)

AdiposeBone MarrowBreast Mammary TissueBrain CerebellumColonColon Colonic MucosaEsophagusHeartHeart VentricleKidneyLiverBrain MidbrainOvaryPancreasBrain PonsKidney CortexEye RetinaMuscle SkeletalSkinSmall IntestineBrain Spinal CordSpleenTestisThymusTracheaHeart ValveMuscle Smooth0123
log10(TPM+1)

Related Sequence

>RPS17P26
GCTCTTTTACCAAGGACCCGCCAACATGTGCCGCGTTTGCACCAAAACCGTGAAGAAGGCGGCCCGGGTCATCATAGAAAAGTACTACACACGCCTGGGCAACGACTTCCACACGAACAAGCGCGTGTGCAAGGAGATCGCCATTATCCCCAGCAAGAAGCTCCGCAACAAGATAGCAGGCTATGTCACGCATCTGATGAAATGGATTCAGAGAGGCCCAGTAAGAGGTATCTCCATCAAGCTGCAGGAGGAGGAGAGAGAAAGGAGAGACAATTATGTTCCTGAGGTCTCAGCCTTGGATCAGGAGATAATTGAAGTAGATCCTGACACTAAGGAAATGCTGAAGCTTTTGGACTTCGGCAGTCTGTCCAACCTGCAGGTCACTCAGCCTACAGTTGGGATGAACTTCAAAATGCCTCGGGGACCTGTTTGAATTTTTTCTGCAGTGCTGTATTATTTTCAATAAATCTGGCACAACAGC
>NM_001021.6
GTTTCCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGCGGCCCGGGTCATCATAGAAAAGTACTACACGCGCCTGGGCAACGACTTCCACACGAACAAGCGCGTGTGCGAGGAGATCGCCATTATCCCCAGCAAAAAGCTCCGCAACAAGATAGCAGGTTATGTCACGCATCTGATGAAGCGAATTCAGAGAGGCCCAGTAAGAGGTATCTCCATCAAGCTGCAGGAGGAGGAGAGAGAAAGGAGAGACAATTATGTTCCTGAGGTCTCAGCCTTGGATCAGGAGATTATTGAAGTAGATCCTGACACTAAGGAAATGCTGAAGCTTTTGGACTTCGGCAGTCTGTCCAACCTTCAGGTCACTCAGCCTACAGTTGGGATGAATTTCAAAACGCCTCGGGGACCTGTTTGAATTTTTTCTGTAGTGCTGTATTATTTTCAATAAATCTGGGACAACAGCCTT

Publications

PMID - Link Title
26598620PAK4 promotes kinase-independent stabilization of RhoU to modulate cell adhesion.
19123937Comparative analysis of processed ribosomal protein pseudogenes in four mammalian genomes.
12477932Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences.