Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name ATP5MC2P5
Plot displaying the genomic locations of a retrocopy (in chr3) and its respective parental gene (in chr12). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr3:130293327-130293910  UCSC
Coordinates (T2T) chr3:133037333-133037916  UCSC
Coordinates (hg19) chr3:130012170-130012753  UCSC
Strand +
Parental Sequence NM_001369755.1
Parental seq. overlap 508 bp
Parental seq. overlap (%) 72.7%
Genomic Region Intergenic
Retrocopy Summary ATP5MC2P5, located on chr3:130293327-130293910, is a retrocopy of the parental gene ATP5MC2. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name ATP5MC2
Full Name ATP synthase membrane subunit c locus 2
Also known as ATP5A|ATP5G2
Coordinate chr12:53665166-53677546
Strand -
Gene summary This gene encodes a subunit of mitochondrial ATP synthase. Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. ATP synthase is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, comprising the proton channel. The catalytic portion of mitochondrial ATP synthase consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled with a stoichiometry of 3 alpha, 3 beta, and single representatives of the gamma, delta, and epsilon subunits. The proton channel likely has nine subunits (a, b, c, d, e, f, g, F6 and 8). There are three separate genes which encode subunit c of the proton channel and they specify precursors with different import sequences but identical mature proteins. The protein encoded by this gene is one of three precursors of subunit c. This gene has multiple pseudogenes. [provided by RefSeq, Jan 2018]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes ATP5MC2P3
Bonobo Pan paniscus ATP5MC2P3
Gorilla Gorilla gorilla ATP5MC2P3
Orangutan Pongo abelii ATP5MC2P3
Gibbon Nomascus leucogenys ATP5MC2P2
Green monkey Chlorocebus sabaeus ATP5G2P2
Crab-eating macaque Macaca fascicularis ATP5G2P2
Rhesus Macaca mulatta ATP5MC2P2
Baboon Papio anubis ATP5MC2P2
Sheep Ovis aries ATP5MC2P1
Golden snub-nosed monkey Rhinopithecus roxellana Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>ATP5MC2P5
ACCCCTAAAAATGTACAGCTGCTCCAAGTGTGCCTCCACCCACTCTTGGTCAAGAGTACCTCCCAGTTGCTGAGCTGCCTACTATCTGCAGTGGTGATGAAATGACCAGAGACACTGACAGATGAGAGCCTCAGCAGCTTGGCAGTCTCACATCCCCTTATCTCACTTGTCCCTACCTGCAACTTCCAAACCAGTGCAATTTCAAGAGACATTGACACAGCAGCCAAGTTTATTGGAGTTGGGGCTGCTACAGTTGGGGTGGCTGGCTCTGGGGCAGGGATTGGTTGGGACTGTGTTTGGGAGCATCATCATTGGTTATGCCAGGAAACCTTCTCTGAAGCAACAGCTCCTCTATCCCATTCTGGGCTTTGCCCTGTGGGAGGTCATGGGGCTCTTTTGCCTGATGATAGCCTCTCTCATTCTTTTTGCCATGTGAATGAGCCATCTCCACCTCCCATAGTTCTTTCTCCTATGTCTCATTGGCCCTGTATGTTCTTTTTTCCTATACATTCCCAGGTAGCCTGGGGAACGTGGTTGGCTCAGGGTTTGACAGAGGGAAGACAAATAAAGAATGTATTAATAAG
>NM_001369755.1
GCAGTCCACGTTACGGATCGGCTTACTCCGCGGAGTTGGCCTCATTTCTGCAGTCGGCGCTCCCTGTAGTTTCTCCTCTCGAACGCCAGCTCTCCTGCCACAGCTCCTCACCCCCTGAAAATGTTCGCCTGCTCCAAGTTTGTCTCCACTCCCTCCTTGGTCAAGAGCACCTCACAGCTGCTGAGCCGTCCGCTATCTGCAGTGGTGCTGAAACGACCGGAGATACTGACAGATGAGAGCCTCAGCAGCTTGGCAGTCTCATGTCCCCTTACCTCACTTGTCTCTAGCCGCAGCTTCCAAACCAGCGCCATTTCAAGGGACATCGACACAGCAGCCAAGTTCATtggagctggggctgccacagttggggtggctggttctggggctgggattggaactgtgtttgggAGCCTCATCATTGGTTATGCCAGGAACCCTTCTCTGAAGCAACAGCTCTTCTCCTACGCCATTCTGGGCTTTGCCCTCTCGGAGGCCATGGGGCTCTTTTGTCTGATGGTAGCCTTTCTCATCCTCTTTGCCATGTGAAGGAGCCGTCTCCACCTCCCATAGTTCTCCCGCGTCTGGTTGGCCCCGTGTGTTCCTTTTCCTATACCTCCCCAGGCAGCCTGGGGAACGTGGTTGGCTCAGGGTTTGACAGAGAAAAGACAAATAAATACTGTATTAATAAGA

Publications

PMID - Link Title