| Retrocopy Name | IFITM1P1 |
|
| Species | Homo sapiens | |
| Coordinates (hg38) | chr3:33727359-33727557 UCSC | |
| Coordinates (T2T) | chr3:33728237-33728435 UCSC | |
| Coordinates (hg19) | chr3:33768851-33769049 UCSC | |
| Strand | - | |
| Parental Sequence | NM_003641.5 | |
| Parental seq. overlap | 169 bp | |
| Parental seq. overlap (%) | 25.2% | |
| Genomic Region |
Intergenic |
|
| Retrocopy Summary | IFITM1P1, located on chr3:33727359-33727557, is a retrocopy of the parental gene IFITM1. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
| Gene Name | IFITM1 |
| Full Name | interferon induced transmembrane protein 1 |
| Also known as | 9-27|CD225|DSPA2a|IFI17|LEU13 |
| Coordinate | chr11:314040-315272 |
| Strand | + |
| Gene summary | Interferon-induced transmembrane (IFITM) proteins are a family of interferon induced antiviral proteins. The family contains five members, including IFITM1, IFITM2 and IFITM3 that belong to the CD225 superfamily. The protein encoded by this gene restricts cellular entry by diverse viral pathogens, such as influenza A virus, Ebola virus and Sars-CoV-2. [provided by RefSeq, Nov 2021] |
| Species | Scientific Name | Retrocopy | |
![]() |
Chimpanzee | Pan troglodytes | IFITM1P2 |
![]() |
Bonobo | Pan paniscus | IFITM1P2 |
![]() |
Gorilla | Gorilla gorilla | IFITM1P1 |
![]() |
Orangutan | Pongo abelii | LOC100455435P2 |
![]() |
Gibbon | Nomascus leucogenys | LOC100594097P2 |
![]() |
Green monkey | Chlorocebus sabaeus | IFITM3P2 |
![]() |
Crab-eating macaque | Macaca fascicularis | LOC102115008P1 |
![]() |
Rhesus | Macaca mulatta | LOC720763P1 |
![]() |
Baboon | Papio anubis | LOC101000441P2 |
![]() |
Golden snub-nosed monkey | Rhinopithecus roxellana | LOC104655295P1 |
![]() |
Marmoset | Callithrix jacchus | Without Homology |
![]() |
Mouse lemur | Microcebus murinus | Without Homology |
![]() |
Mouse | Mus musculus | Without Homology |
![]() |
Rat | Rattus norvegicus | Without Homology |
![]() |
Chinese hamster | Cricetulus griseus | Without Homology |
![]() |
Rabbit | Oryctolagus cuniculus | Without Homology |
![]() |
Pig | Sus scrofa | Without Homology |
![]() |
Cow | Bos taurus | Without Homology |
![]() |
Sheep | Ovis aries | Without Homology |
![]() |
Dolphin | Tursiops truncatus | Without Homology |
![]() |
Horse | Equus caballus | Without Homology |
![]() |
Dog | Canis familiaris | Without Homology |
![]() |
Panda | Ailuropoda melanoleuca | Without Homology |
![]() |
Cat | Felis catus | Without Homology |
![]() |
Pale spear-nosed bat | Phyllostomus discolor | Without Homology |
![]() |
Velvety free-tailed bat | Molossus molossus | Without Homology |
![]() |
Greater mouse-eared bat | Myotis myotis | Without Homology |
![]() |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
![]() |
Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology |
![]() |
Egyptian rousette | Rousettus aegyptiacus | Without Homology |
![]() |
Sloth | Choloepus didactylus | Without Homology |
![]() |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
![]() |
Opossum | Monodelphis domestica | Without Homology |
![]() |
Platypus | Ornithorhynchus anatinus | Without Homology |
![]() |
Chicken | Gallus gallus | Without Homology |
![]() |
Turkey | Meleagris gallopavo | Without Homology |
![]() |
Zebra Finch | Taeniopygia guttata | Without Homology |
![]() |
Budgerigar | Melopsittacus undulatus | Without Homology |
![]() |
Painted Turtle | Chrysemys picta | Without Homology |
![]() |
Lizard | Anolis Carolinensis | Without Homology |
![]() |
Frog | Xenopus tropicalis | Without Homology |
![]() |
Zebrafish | Danio rerio | Without Homology |
![]() |
Drosophila | Drosophila melanogaster | Without Homology |
| >IFITM1P1 |
| TCCACCGTGATCCACAACCACAGTGATACCACCATGTCTGACCTTGTTGTCTGGTCCCTGTTCAATTCGCTCTTCGTTGAACTGATGCTGCCTGAGCTTCATAGCACTGGCCTACTCTGTGAAATCTAGGGACAGGAAGATGGTTGGCAACCTGACTGGGGCCCTACCATGCTTCCACTGCAAAGTGCCTGAACATCTA |
| >NM_003641.5 |
| GAAACGACAGGGGAAAGGAGGTCTCACTGAGCACCGTCCCAGCATCCGGACACCACAGCGGCCCTTCGCTCCACGCAGAAAACCACACTTCTCAAACCTTCACTCAACACTTCCTTCCCCAAAGCCAGAAGATGCACAAGGAGGAACATGAGGTGGCTGTGCTGGGGCCACCCCCCAGCACCATCCTTCCAAGGTCCACCGTGATCAACATCCACAGCGAGACCTCCGTGCCCGACCATGTCGTCTGGTCCCTGTTCAACACCCTCTTCTTGAACTGGTGCTGTCTGGGCTTCATAGCATTCGCCTACTCCGTGAAGTCTAGGGACAGGAAGATGGTTGGCGACGTGACCGGGGCCCAGGCCTATGCCTCCACCGCCAAGTGCCTGAACATCTGGGCCCTGATTCTGGGCATCCTCATGACCATTGGATTCATCCTGTTACTGGTATTCGGCTCTGTGACAGTCTACCATATTATGTTACAGATAATACAGGAAAAACGGGGTTACTAGTAGCCGCCCATAGCCTGCAACCTTTGCACTCCACTGTGCAATGCTGGCCCTGCACGCTGGGGCTGTTGCCCCTGCCCCCTTGGTCCTGCCCCTAGATACAGCAGTTTATACCCACACACCTGTCTACAGTGTCATTCAATAAAGTGCACGTGCTTGTGA |
| PMID - Link | Title |
|---|