Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name IFITM1P1
Plot displaying the genomic locations of a retrocopy (in chr3) and its respective parental gene (in chr11). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr3:33727359-33727557  UCSC
Coordinates (T2T) chr3:33728237-33728435  UCSC
Coordinates (hg19) chr3:33768851-33769049  UCSC
Strand -
Parental Sequence NM_003641.5
Parental seq. overlap 169 bp
Parental seq. overlap (%) 25.2%
Genomic Region Intergenic
Retrocopy Summary IFITM1P1, located on chr3:33727359-33727557, is a retrocopy of the parental gene IFITM1. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name IFITM1
Full Name interferon induced transmembrane protein 1
Also known as 9-27|CD225|DSPA2a|IFI17|LEU13
Coordinate chr11:314040-315272
Strand +
Gene summary Interferon-induced transmembrane (IFITM) proteins are a family of interferon induced antiviral proteins. The family contains five members, including IFITM1, IFITM2 and IFITM3 that belong to the CD225 superfamily. The protein encoded by this gene restricts cellular entry by diverse viral pathogens, such as influenza A virus, Ebola virus and Sars-CoV-2. [provided by RefSeq, Nov 2021]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes IFITM1P2
Bonobo Pan paniscus IFITM1P2
Gorilla Gorilla gorilla IFITM1P1
Orangutan Pongo abelii LOC100455435P2
Gibbon Nomascus leucogenys LOC100594097P2
Green monkey Chlorocebus sabaeus IFITM3P2
Crab-eating macaque Macaca fascicularis LOC102115008P1
Rhesus Macaca mulatta LOC720763P1
Baboon Papio anubis LOC101000441P2
Golden snub-nosed monkey Rhinopithecus roxellana LOC104655295P1
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>IFITM1P1
TCCACCGTGATCCACAACCACAGTGATACCACCATGTCTGACCTTGTTGTCTGGTCCCTGTTCAATTCGCTCTTCGTTGAACTGATGCTGCCTGAGCTTCATAGCACTGGCCTACTCTGTGAAATCTAGGGACAGGAAGATGGTTGGCAACCTGACTGGGGCCCTACCATGCTTCCACTGCAAAGTGCCTGAACATCTA
>NM_003641.5
GAAACGACAGGGGAAAGGAGGTCTCACTGAGCACCGTCCCAGCATCCGGACACCACAGCGGCCCTTCGCTCCACGCAGAAAACCACACTTCTCAAACCTTCACTCAACACTTCCTTCCCCAAAGCCAGAAGATGCACAAGGAGGAACATGAGGTGGCTGTGCTGGGGCCACCCCCCAGCACCATCCTTCCAAGGTCCACCGTGATCAACATCCACAGCGAGACCTCCGTGCCCGACCATGTCGTCTGGTCCCTGTTCAACACCCTCTTCTTGAACTGGTGCTGTCTGGGCTTCATAGCATTCGCCTACTCCGTGAAGTCTAGGGACAGGAAGATGGTTGGCGACGTGACCGGGGCCCAGGCCTATGCCTCCACCGCCAAGTGCCTGAACATCTGGGCCCTGATTCTGGGCATCCTCATGACCATTGGATTCATCCTGTTACTGGTATTCGGCTCTGTGACAGTCTACCATATTATGTTACAGATAATACAGGAAAAACGGGGTTACTAGTAGCCGCCCATAGCCTGCAACCTTTGCACTCCACTGTGCAATGCTGGCCCTGCACGCTGGGGCTGTTGCCCCTGCCCCCTTGGTCCTGCCCCTAGATACAGCAGTTTATACCCACACACCTGTCTACAGTGTCATTCAATAAAGTGCACGTGCTTGTGA

Publications

PMID - Link Title