Retrocopy Name | RPS27P36 |
|
Species | Homo sapiens | |
Coordinates (hg38) | chr3:48039254-48039456 UCSC | |
Coordinates (T2T) | chr3:48066558-48066760 UCSC | |
Coordinates (hg19) | chr3:48080744-48080946 UCSC | |
Strand | + | |
Parental Sequence | NM_001030.6 | |
Parental seq. overlap | 180 bp | |
Parental seq. overlap (%) | 50.8% | |
Genomic Region |
Intragenic (MAP4) |
|
Retrocopy Summary | RPS27P36, located on chr3:48039254-48039456, is a retrocopy of the parental gene RPS27. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
Gene Name | RPS27 |
Full Name | ribosomal protein S27 |
Also known as | DBA17|MPS-1|MPS1|S27 |
Coordinate | chr1:153990762-153992155 |
Strand | + |
Gene summary | Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of four RNA species and approximately 80 structurally distinct proteins. This gene encodes a member of the S27e family of ribosomal proteins and component of the 40S subunit. The encoded protein contains a C4-type zinc finger domain that can bind to zinc and may bind to nucleic acid. Mutations in this gene have been identified in numerous melanoma patients and in at least one patient with Diamond-Blackfan anemia (DBA). Elevated expression of this gene has been observed in various human cancers. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2018] |
Species | Scientific Name | Retrocopy | |
![]() |
Chimpanzee | Pan troglodytes | RPS27P9 |
![]() |
Bonobo | Pan paniscus | RPS27P8 |
![]() |
Gorilla | Gorilla gorilla | RPS27P8 |
![]() |
Orangutan | Pongo abelii | RPS27P9 |
![]() |
Gibbon | Nomascus leucogenys | RPS27P7 |
![]() |
Green monkey | Chlorocebus sabaeus | RPS27P24 |
![]() |
Crab-eating macaque | Macaca fascicularis | RPS27P7 |
![]() |
Rhesus | Macaca mulatta | RPS27P7 |
![]() |
Baboon | Papio anubis | RPS27P11 |
![]() |
Golden snub-nosed monkey | Rhinopithecus roxellana | RPS27P3 |
![]() |
Marmoset | Callithrix jacchus | RPS27P36 |
![]() |
Mouse lemur | Microcebus murinus | Without Homology |
![]() |
Mouse | Mus musculus | Without Homology |
![]() |
Rat | Rattus norvegicus | Without Homology |
![]() |
Chinese hamster | Cricetulus griseus | Without Homology |
![]() |
Rabbit | Oryctolagus cuniculus | Without Homology |
![]() |
Pig | Sus scrofa | Without Homology |
![]() |
Cow | Bos taurus | Without Homology |
![]() |
Sheep | Ovis aries | Without Homology |
![]() |
Dolphin | Tursiops truncatus | Without Homology |
![]() |
Horse | Equus caballus | Without Homology |
![]() |
Dog | Canis familiaris | Without Homology |
![]() |
Panda | Ailuropoda melanoleuca | Without Homology |
![]() |
Cat | Felis catus | Without Homology |
![]() |
Pale spear-nosed bat | Phyllostomus discolor | Without Homology |
![]() |
Velvety free-tailed bat | Molossus molossus | Without Homology |
![]() |
Greater mouse-eared bat | Myotis myotis | Without Homology |
![]() |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
![]() |
Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology |
![]() |
Egyptian rousette | Rousettus aegyptiacus | Without Homology |
![]() |
Sloth | Choloepus didactylus | Without Homology |
![]() |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
![]() |
Opossum | Monodelphis domestica | Without Homology |
![]() |
Platypus | Ornithorhynchus anatinus | Without Homology |
![]() |
Chicken | Gallus gallus | Without Homology |
![]() |
Turkey | Meleagris gallopavo | Without Homology |
![]() |
Zebra Finch | Taeniopygia guttata | Without Homology |
![]() |
Budgerigar | Melopsittacus undulatus | Without Homology |
![]() |
Painted Turtle | Chrysemys picta | Without Homology |
![]() |
Lizard | Anolis Carolinensis | Without Homology |
![]() |
Frog | Xenopus tropicalis | Without Homology |
![]() |
Zebrafish | Danio rerio | Without Homology |
![]() |
Drosophila | Drosophila melanogaster | Without Homology |
>RPS27P36 |
TCACGAGAACAGGCCTCTCACAAAGAATCTCCCTCCCTCTCCAGAAAAAAAGAGCAAGCACAAGAAGTGCCTGGTGCAGAGCCCCAATTCTTACTTCCTGAACGTGAAATGCCCAGGATGCTATAAAATCACCATGGTCGTCAGTCATGCACAATAGTAGTTGTGTGTCTGGCTGCTCTGCTGTCCTCTGCCAGCCTACAGGA |
>NM_001030.6 |
CCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTCATCCCTCTCCAGAAGAGGAGAAGAGGAAACACAAGAAGAAACGCCTGGTGCAGAGCCCCAATTCCTACTTCATGGATGTGAAATGCCCAGGATGCTATAAAATCACCACGGTCTTTAGCCATGCACAAACGGTAGTTTTGTGTGTTGGCTGCTCCACTGTCCTCTGCCAGCCTACAGGAGGAAAAGCAAGGCTTACAGAAGGATGTTCCTTCAGGAGGAAGCAGCACTAAAAGCACTCTGAGTCAAGATGAGTGGGAAACCATCTCAATAAACACATTTTGGATAAATCCTG |
PMID - Link | Title |
---|