Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name RPL35AP12
Wait
Plot displaying the genomic locations of a retrocopy (in chr4) and its respective parental gene (in chr3). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr4:163382241-163382566  UCSC
Coordinates (T2T) chr4:166730054-166730379  UCSC
Coordinates (hg19) chr4:164303393-164303718  UCSC
Strand +
Parental Sequence NM_000996.4
Parental seq. overlap 274 bp
Parental seq. overlap (%) 22.2%
Genomic Region Intergenic
Retrocopy Summary RPL35AP12, located on chr4:163382241-163382566, is a retrocopy of the parental gene RPL35A. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name RPL35A
Full Name ribosomal protein L35a
Also known as DBA5|L35A|eL33
Coordinate chr3:197950190-197956610
Strand +
Gene summary Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L35AE family of ribosomal proteins. It is located in the cytoplasm. The rat protein has been shown to bind to both initiator and elongator tRNAs, and thus, it is located at the P site, or P and A sites, of the ribosome. Although this gene was originally mapped to chromosome 18, it has been established that it is located at 3q29-qter. Alternative splicing results in multiple transcript variants. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Oct 2015]

Homology

Species Scientific Name Retrocopy
Bonobo Pan paniscus RPL35AP6
Gorilla Gorilla gorilla RPL35AP7
Orangutan Pongo abelii RPL35AP7
Gibbon Nomascus leucogenys RPL35AP13
Green monkey Chlorocebus sabaeus RPL35AP11
Crab-eating macaque Macaca fascicularis RPL35AP11
Rhesus Macaca mulatta RPL35AP11
Baboon Papio anubis LOC101014662P7
Golden snub-nosed monkey Rhinopithecus roxellana RPL35AP6
Marmoset Callithrix jacchus RPL35AP12
Chimpanzee Pan troglodytes Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

The Genotype-Tissue Expression project - (GTEx)

Adipose SubcutaneousMuscle SkeletalArtery TibialArtery CoronaryHeart Atrial AppendageAdipose VisceralUterusVaginaBreast Mammary TissueSkin Not Sun ExposedMinor Salivary GlandBrain CortexAdrenal GlandThyroidLungSpleenPancreasEsophagus MuscularisEsophagus MucosaEsophagus Gastroesophageal JunctionStomachColon SigmoidSmall Intestine Terminal IleumColon TransverseProstateTestisNerve TibialSkin Sun ExposedHeart Left VentricleBrain CerebellumWhole BloodArtery AortaPituitaryBrain Frontal CortexBrain CaudateBrain Nucleus AccumbensBrain PutamenBrain HypothalamusBrain Spinal CordBrain HippocampusBrain Anterior Cingulate CortexOvaryBrain Cerebellar HemisphereLiverBrain Substantia NigraKidney CortexBrain AmygdalaCervix EctocervixFallopian TubeCervix EndocervixBladderKidney Medulla00.050.10.15
log10(TPM+1)

Massive Mining of Publicly Available RNA-seq Data from Human and Mouse - (ARCHS4)

AdiposeBone MarrowBreast Mammary TissueBrain CerebellumColonColon Colonic MucosaEsophagusHeartHeart VentricleKidneyLiverBrain MidbrainOvaryPancreasBrain PonsKidney CortexEye RetinaMuscle SkeletalSkinSmall IntestineBrain Spinal CordSpleenTestisThymusTracheaHeart ValveMuscle Smooth012
log10(TPM+1)

Related Sequence

>RPL35AP12
AAACCAAACGGAGAACACAGCTCTTCTTCAAACTGAAGGTGGTTATGCCTGAGATGAAACTGAATTCTACTCAGGCAAGAGATGTGCTTATGTATATAGAGCAAATCACAACACAGTGACGTCAGTGATAAACCAAACCAAACAAAAGTAATCTGGGGAAAGGTAACCTGTGTCCATGGAAACAGTGGCATGATTTGTGCCAAATTCTGAAGCAATCTGCCTATTAAGGGCACTGGACACAGAATCCGTGTGAAGCTGTACCCCTAAAGGTTTTAAACTGATGAAAAGTAAATCAATAAAGGGGGAATTTGTGCTCTGGTATTTTT
>NM_000996.4
CTTCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAACTATGTCTGGAAGGCTGTGGTCCAAGGCCATTTTTGCTGGCTATAAGCGGGGTCTCCGGAACCAAAGGGAGCACACAGCTCTTCTTAAAATTGAAGGTGTTTACGCCCGAGATGAAACAGAATTCTATTTGGGCAAGAGATGCGCTTATGTATATAAAGCAAAGAACAACACAGTCACTCCTGGCGGCAAACCAAACAAAACCAGAGTCATCTGGGGAAAAGTAACTCGGGCCCATGGAAACAGTGGCATGGTTCGTGCCAAATTCCGAAGCAATCTTCCTGCTAAGGCCATTGGACACAGAATCCGAGTGATGCTGTACCCCTCAAGGATTTAAACTAACGAAAAATCAATAAATAAATGTGGATTTGTGCTCTTGTATTTTTAAGTGGATTAAAAAACTTACTACCTTAAATTGATTTGCTACATGCTTAAAATGATAGAGGTTGCTCAGCATTTTTGGAGTACAAGGGGGTCAGAGAGACATGTGATGAAAATTACAGGGCGAGTACAGAGATTTAGAAGGGAACGGGTTTTAATGCGAGTATCTTTgacagagtcttgctctgttgcccatgctggagtgtagtggtgctcgctgcagcctcacattcaaaggctcaagcaatcctcccttggcctttgaagtagctgggaccacaggctcatgccaccatccctgggtcatttttaaattttttgtagagagggtctgactcttgcctatgctggcttcaaactcctgggctcaagcaatcctccttccttggcctctcctgaagtgctgggatacagttatgagccaccacacctgCCAAGTGCTTTGTGATACTATGCATTTGTTCAATGCAGATTGGGAAACTTAAAATTTGAATGGAGATTATGTTGATGGGCTTTGGCAGTTCATTTGGATAGACTGGGATGAGAAGCTCTTGGGACTTGTGACTGGACAAAGCATTCCAGTATATTAAAATAAAATTAAGCCATATTACTCCACTCATAAAAAGCAATCCTATGGTAGGTACATGGAGGTTGGGAATAGTGCACGGAAAGGTGGCAGCTTTCTTTGGCTTCATGTTTTAATCTGGTAAAGTTCAAGATTGCACTTTAAGCAGGCCTCCTAAATATTTTAGATTTCTTGGGGATATGCTAAAATAAAACAACTAAGGCATCA

Publications

PMID - Link Title
19123937Comparative analysis of processed ribosomal protein pseudogenes in four mammalian genomes.