Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name RPLP1P18
Wait
Plot displaying the genomic locations of a retrocopy (in chr4) and its respective parental gene (in chr15). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr4:60038414-60038621  UCSC
Coordinates (T2T) chr4:63482400-63482607  UCSC
Coordinates (hg19) chr4:60904132-60904339  UCSC
Strand +
Parental Sequence NM_001003.3
Parental seq. overlap 168 bp
Parental seq. overlap (%) 14.3%
Genomic Region Intergenic
Retrocopy Summary RPLP1P18, located on chr4:60038414-60038621, is a retrocopy of the parental gene RPLP1. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name RPLP1
Full Name ribosomal protein lateral stalk subunit P1
Also known as LP1|P1|RPP1
Coordinate chr15:69452818-69456205
Strand +
Gene summary Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal phosphoprotein that is a component of the 60S subunit. The protein, which is a functional equivalent of the E. coli L7/L12 ribosomal protein, belongs to the L12P family of ribosomal proteins. It plays an important role in the elongation step of protein synthesis. Unlike most ribosomal proteins, which are basic, the encoded protein is acidic. Its C-terminal end is nearly identical to the C-terminal ends of the ribosomal phosphoproteins P0 and P2. The P1 protein can interact with P0 and P2 to form a pentameric complex consisting of P1 and P2 dimers, and a P0 monomer. The protein is located in the cytoplasm. Two alternatively spliced transcript variants that encode different proteins have been observed. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]

Homology

Species Scientific Name Retrocopy
Golden snub-nosed monkey Rhinopithecus roxellana RPLP1P2
Chimpanzee Pan troglodytes Without Homology
Bonobo Pan paniscus Without Homology
Gorilla Gorilla gorilla Without Homology
Orangutan Pongo abelii Without Homology
Gibbon Nomascus leucogenys Without Homology
Green monkey Chlorocebus sabaeus Without Homology
Crab-eating macaque Macaca fascicularis Without Homology
Rhesus Macaca mulatta Without Homology
Baboon Papio anubis Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

The Genotype-Tissue Expression project - (GTEx)

Adipose SubcutaneousMuscle SkeletalArtery TibialArtery CoronaryHeart Atrial AppendageAdipose VisceralUterusVaginaBreast Mammary TissueSkin Not Sun ExposedMinor Salivary GlandBrain CortexAdrenal GlandThyroidLungSpleenPancreasEsophagus MuscularisEsophagus MucosaEsophagus Gastroesophageal JunctionStomachColon SigmoidSmall Intestine Terminal IleumColon TransverseProstateTestisNerve TibialSkin Sun ExposedHeart Left VentricleBrain CerebellumWhole BloodArtery AortaPituitaryBrain Frontal CortexBrain CaudateBrain Nucleus AccumbensBrain PutamenBrain HypothalamusBrain Spinal CordBrain HippocampusBrain Anterior Cingulate CortexOvaryBrain Cerebellar HemisphereLiverBrain Substantia NigraKidney CortexBrain AmygdalaCervix EctocervixFallopian TubeCervix EndocervixBladderKidney Medulla00.10.2
log10(TPM+1)

Massive Mining of Publicly Available RNA-seq Data from Human and Mouse - (ARCHS4)

AdiposeBone MarrowBreast Mammary TissueBrain CerebellumColonColon Colonic MucosaEsophagusHeartHeart VentricleKidneyLiverBrain MidbrainOvaryPancreasBrain PonsKidney CortexEye RetinaMuscle SkeletalSkinSmall IntestineBrain Spinal CordSpleenTestisThymusTracheaHeart ValveMuscle Smooth012
log10(TPM+1)

Related Sequence

>RPLP1P18
AGAGCCTCATCTGCAATGTAGCAGCTGGTGGAGCTGCCCCAGCAGCAGGTGCTACACTGGTAGGAGATACTACCCCTTCCTCAGCTACTGCTGAAGCTAGGGAGAAGAAAGGAGAACAAAGAGAGGAATATGAGGAGTCCTACCATAACGTGGGCTTCAGGCTTTTTGACTAAACTTCTGTTGTAACATTTCAATAAAGAGCTGAACT
>NM_001003.3
CCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGGGGTGAGGCCCTCACTTCATCCGGCGACTAGCACCGCGTCCGGCAGCGCCAGCCCTACACTCGCCCGCGCCATGGCCTCTGTCTCCGAGCTCGCCTGCATCTACTCGGCCCTCATTCTGCACGACGATGAGGTGACAGTCACGGAGGATAAGATCAATGCCCTCATTAAAGCAGCCGGTGTAAATGTTGAGCCTTTTTGGCCTGGCTTGTTTGCAAAGGCCCTGGCCAACGTCAACATTGGGAGCCTCATCTGCAATGTAGGGGCCGGTGGACCTGCTCCAGCAGCTGGTGCTGCACCAGCAGGAGGTCCTGCCCCCTCCACTGCTGCTGCTCCAGCTGAGGAGAAGAAAGTGGAAGCAAAGAAAGAAGAATCCGAGGAGTCTGATGATGACATGGGCTTTGGTCTTTTTGACTAAACCTCTTTTATAACATGTTCAATAAAAAGCTGAACTTTACTGCTGTTGGTCTTGTCCATAGTTTTGGAATGTGCTCTGCAAAAATGGTCTGTTTTGTAATGTTGGCTTTCAGCCTATTCTGCCATGACACAGGCTGGATTTTCCCTGCCACCATTGCCGGATGTGAGATTTAGACAATCCTGATGCTAACAAGAAGGCACCTCATGGTACAGTGTTGAAAACTGCACTGGGGTGGCAGGAGGAAGGATCAGAGCAGATGCTTTGTCCAGGTTACCTGTGTAAACTTGATGATTATAAGGTGTGTCCCCTACACTGGGGGTGGAGGGTAATACAGACCAGCTTTAGAAAGCCTCCTGGGTATTTACCCTATACAACCCTGCCTAAGAACGAACTTTGACGTATGCTGAATGTTGACTGCTACATCCCAAGGTTGTAAAAAAACAAGACTTAGCTATGTAATGTCTCACCAAATGTTTGGGAGTTTTATGGTAACACTGAAGGAGTGCAGAAAGTTTACTTAATAGTTTATTAAGGTCTCCAGTTACACAAAGTGGAAAAAAAAAAAGATTCAAACCTGTGTTCCAAAAACTAAGAGCTTTTTTTGTTTGCCAATTAATAATACCATGAATGGAATTTTCAACTTTTCAGGCTTGGATTTATATAATAAACCGTGGGTATTGTGTGTTCAGAGCAGCTAA

Publications

PMID - Link Title
No publications available for this retrocopy