Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name RPS27AP10
Plot displaying the genomic locations of a retrocopy (in chr5) and its respective parental gene (in chr2). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr5:141588926-141589428  UCSC
Coordinates (T2T) chr5:142114915-142115417  UCSC
Coordinates (hg19) chr5:140968493-140968995  UCSC
Strand +
Parental Sequence NM_001177413.1
Parental seq. overlap 425 bp
Parental seq. overlap (%) 47.2%
Genomic Region Intragenic (DIAPH1)
Retrocopy Summary RPS27AP10, located on chr5:141588926-141589428, is a retrocopy of the parental gene RPS27A. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name RPS27A
Full Name ribosomal protein S27a
Also known as CEP80|HEL112|S27A|UBA80|UBC|UBCEP1|UBCEP80
Coordinate chr2:55231903-55235853
Strand +
Gene summary Ubiquitin, a highly conserved protein that has a major role in targeting cellular proteins for degradation by the 26S proteosome, is synthesized as a precursor protein consisting of either polyubiquitin chains or a single ubiquitin fused to an unrelated protein. This gene encodes a fusion protein consisting of ubiquitin at the N terminus and ribosomal protein S27a at the C terminus. When expressed in yeast, the protein is post-translationally processed, generating free ubiquitin monomer and ribosomal protein S27a. Ribosomal protein S27a is a component of the 40S subunit of the ribosome and belongs to the S27AE family of ribosomal proteins. It contains C4-type zinc finger domains and is located in the cytoplasm. Pseudogenes derived from this gene are present in the genome. As with ribosomal protein S27a, ribosomal protein L40 is also synthesized as a fusion protein with ubiquitin; similarly, ribosomal protein S30 is synthesized as a fusion protein with the ubiquitin-like protein fubi. Multiple alternatively spliced transcript variants that encode the same proteins have been identified.[provided by RefSeq, Sep 2008]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes RPS27AP6
Bonobo Pan paniscus RPS27AP6
Gorilla Gorilla gorilla RPS27AP9
Orangutan Pongo abelii RPS27AP7
Gibbon Nomascus leucogenys RPS27AP3
Green monkey Chlorocebus sabaeus RPS27AP18
Crab-eating macaque Macaca fascicularis RPS27AP6
Rhesus Macaca mulatta RPS27AP6
Baboon Papio anubis RPS27AP6
Golden snub-nosed monkey Rhinopithecus roxellana LOC104673976P3
Marmoset Callithrix jacchus RPS27AP9
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>RPS27AP10
ACCACCAAAACACAAATTTTCATAAAAATCCTTATGGGGGAGGCCATCACTCTTGAGGTTGAATCCTTGGATAAAACAGAAAATATAAAGGCCAACATCCAGGATAAGAAAGGAATTCCTCCTGACCAATAAAGACTGATCTTTGCTGGCAAGCAACTAGAAGGTAGATGTGCTTTGTCTGACTACAGCATTCAAAAGGAGTCCACTCTTCATCTTGAGACTTTGTGGTGGGGCTAAGAAAAAGAAGTTTTACACTACTCCCAAGAAGAATAAGCATGAGAAAGAAGGTGAAGCTGGCTGTCCTGAAATCCCATAAGGCCAATGAGAATGGCAAAAGTAGCCACCTTCGTTGGGAGTGCCCTTCAGATGGATGTAGTGTTACAGTGTTTATGGCCGGCTGGCCACTCTGACAGATATTATTGTGACAAAAGTTGTCTGATTTATTGCTTCAACAAACCAGAAGACAAATAATTGTGTATGAGTTAATGAAAGATGTGAACTAA
>NM_001177413.1
GGCGTTCTTCCTTTTCGATCCGCCATCTGCGGTGGGTGTCTGCACTTCGGCTGCTCTCGGGTTAGCACCCTATGGTGCCTTCTCTTGTGATCCCTGACCTAACCTGTCTCTTCCTTTTCCTCAACCTCAGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAACCCTTACGGGGAAGACCATCACCCTCGAGGTTGAACCCTCGGATACGATAGAAAATGTAAAGGCCAAGATCCAGGATAAGGAAGGAATTCCTCCTGATCAGCAGAGACTGATCTTTGCTGGCAAGCAGCTGGAAGATGGACGTACTTTGTCTGACTACAATATTCAAAAGGAGTCTACTCTTCATCTTGTGTTGAGACTTCGTGGTGGTGCTAAGAAAAGGAAGAAGAAGTCTTACACCACTCCCAAGAAGAATAAGCACAAGAGAAAGAAGGTTAAGCTGGCTGTCCTGAAATATTATAAGGTGGATGAGAATGGCAAAATTAGTCGCCTTCGTCGAGAGTGCCCTTCTGATGAATGTGGTGCTGGGGTGTTTATGGCAAGTCACTTTGACAGACATTATTGTGGCAAATGTTGTCTGACTTACTGTTTCAACAAACCAGAAGACAAGTAACTGTATGAGTTAATAAAAGACATGAACTAACATTTATTGTTGGGTTTTATTGCAGTAAAAAGAATGGTTTTTAAGCACCAAATTGATGGTCACACCATTTCCTTTTAGTAGTGCTACTGCTATCGCTGTGTGAATGTTGCCTCTGGGGATTATGTGACCCAGTGGTTCTGTATACCTGCCAGGTGCCAACCACTTGTAAAGGTCTTGATATTTTCAATTCTTAGACTACCTATACTTTGGCAGAAGTTATATTTAATGTAAGTTGTCTAAATATAA

Publications

PMID - Link Title