Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name RPL36AP21
Plot displaying the genomic locations of a retrocopy (in chr5) and its respective parental gene (in chrX). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr5:18049549-18049872  UCSC
Coordinates (T2T) chr5:18051323-18051646  UCSC
Coordinates (hg19) chr5:18049658-18049981  UCSC
Strand +
Parental Sequence NM_021029.6
Parental seq. overlap 284 bp
Parental seq. overlap (%) 37.2%
Genomic Region Intergenic
Retrocopy Summary RPL36AP21, located on chr5:18049549-18049872, is a retrocopy of the parental gene RPL36A. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name RPL36A
Full Name ribosomal protein L36a
Also known as L36A|L44L|MIG6|RPL44
Coordinate chrX:101391011-101396155
Strand +
Gene summary Cytoplasmic ribosomes, organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein, which shares sequence similarity with yeast ribosomal protein L44, belongs to the L44E (L36AE) family of ribosomal proteins. Although this gene has been referred to as ribosomal protein L44 (RPL44), its official name is ribosomal protein L36a (RPL36A). This gene and the human gene officially named ribosomal protein L36a-like (RPL36AL) encode nearly identical proteins; however, they are distinct genes. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Naturally occurring read-through transcription occurs between this locus and the heterogeneous nuclear ribonucleoprotein H2 (H') gene. [provided by RefSeq, Jan 2011]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes RPL36ALP1
Bonobo Pan paniscus RPL36ALP1
Gorilla Gorilla gorilla RPL36ALP2
Orangutan Pongo abelii RPL36ALP1
Gibbon Nomascus leucogenys LOC100595785P8
Green monkey Chlorocebus sabaeus Without Homology
Crab-eating macaque Macaca fascicularis Without Homology
Rhesus Macaca mulatta Without Homology
Baboon Papio anubis Without Homology
Golden snub-nosed monkey Rhinopithecus roxellana Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>RPL36AP21
GATGGTCAACGTACCTAAAACCGGAAGAACCTTCTGTAAGAAGTGTGGCAAGCATCAGCCTCACAAAGTGACACAGTATAAGAAGGGTAAGGATTCTTTGTATGCCTAGGGAAAGTGGCACTATGATCGGAAGCAGAGTGGCTATGGTGGGCAGACAAAGCCAATTTTCTGGAAGAAGGCTAAGACCACAAAGAAGATTGTGCTAAGGCTGGACAATGTGTTGAGCCTAACTGCAGATCCAAGAGGATGCTGGCCATTAAGAGATGCAAGCATTTTGAACTGGGAGGAGATAGGAAGAGAAAGGGCCAAGTGATCCAGTTCTAA
>NM_021029.6
CTTTCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCCGGACTTTCTGTAAGAAGTGTGGCAAGCACCAACCCCATAAAGTGACACAGTACAAGAAGGGCAAGGATTCTCTGTACGCCCAGGGAAAGCGGCGTTATGACAGGAAGCAGAGTGGCTATGGTGGGCAAACTAAGCCGATTTTCCGGAAAAAGGCTAAAACTACAAAGAAGATTGTGCTAAGGCTTGAGTGCGTTGAGCCCAACTGCAGATCTAAGAGAATGCTGGCTATTAAAAGATGCAAGCATTTTGAACTGGGAGGAGATAAGAAGAGAAAGGGCCAAGTGATCCAGTTCTAAGTGTCATCTTTTATTATGAAGACAATAAAATCTTGAGTTTATGTTCACTTCATTTGTTTGCTGTTCATCTTTTGGGAGGGAATAAGCTAGAGCCATCAATACAATTCCGCTTGTGGGGAAATTTATGCCTCTTACTGGTACTACTTGTTTTGCATTGAAGCTGACTGGTTGAGTTCACATCATATGTTGCAATTTTCTAATTTGGCACTTCAATCACTAGGGGCCTTATGAGGCAGTTTGTCATTATGCAATGGTTATTGGTTATCATGTGAGTAGACACATTTCAGGCTAATAGGGAGAAGTCAGTAACACATTCATAGTGAATATGAGATGTCTTTGCTAAGAGTTAAGTGTCAGATCTTTGTTATAACAGTTAATTTAATAAAGAATTTTGGCATTGTTCTTCA

Publications

PMID - Link Title