Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name RPL18P15
Wait
Plot displaying the genomic locations of a retrocopy (in chr7) and its respective parental gene (in chr19). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr7:121440820-121441257  UCSC
Coordinates (T2T) chr7:122756107-122756544  UCSC
Coordinates (hg19) chr7:121080874-121081311  UCSC
Strand -
Parental Sequence NM_001270490.2
Parental seq. overlap 403 bp
Parental seq. overlap (%) 72.5%
Genomic Region Intergenic
Retrocopy Summary RPL18P15, located on chr7:121440820-121441257, is a retrocopy of the parental gene RPL18. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name RPL18
Full Name ribosomal protein L18
Also known as DBA18|L18
Coordinate chr19:48615331-48619178
Strand -
Gene summary Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a member of the L18E family of ribosomal proteins that is a component of the 60S subunit. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes RPL18P2
Bonobo Pan paniscus RPL18P2
Orangutan Pongo abelii RPL18P2
Gibbon Nomascus leucogenys RPL18P11
Gorilla Gorilla gorilla Without Homology
Green monkey Chlorocebus sabaeus Without Homology
Crab-eating macaque Macaca fascicularis Without Homology
Rhesus Macaca mulatta Without Homology
Baboon Papio anubis Without Homology
Golden snub-nosed monkey Rhinopithecus roxellana Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

The Genotype-Tissue Expression project - (GTEx)

Adipose SubcutaneousMuscle SkeletalArtery TibialArtery CoronaryHeart Atrial AppendageAdipose VisceralUterusVaginaBreast Mammary TissueSkin Not Sun ExposedMinor Salivary GlandBrain CortexAdrenal GlandThyroidLungSpleenPancreasEsophagus MuscularisEsophagus MucosaEsophagus Gastroesophageal JunctionStomachColon SigmoidSmall Intestine Terminal IleumColon TransverseProstateTestisNerve TibialSkin Sun ExposedHeart Left VentricleBrain CerebellumWhole BloodArtery AortaPituitaryBrain Frontal CortexBrain CaudateBrain Nucleus AccumbensBrain PutamenBrain HypothalamusBrain Spinal CordBrain HippocampusBrain Anterior Cingulate CortexOvaryBrain Cerebellar HemisphereLiverBrain Substantia NigraKidney CortexBrain AmygdalaCervix EctocervixFallopian TubeCervix EndocervixBladderKidney Medulla00.20.40.6
log10(TPM+1)

Massive Mining of Publicly Available RNA-seq Data from Human and Mouse - (ARCHS4)

AdiposeBone MarrowBreast Mammary TissueBrain CerebellumColonColon Colonic MucosaEsophagusHeartHeart VentricleKidneyLiverBrain MidbrainOvaryPancreasBrain PonsKidney CortexEye RetinaMuscle SkeletalSkinSmall IntestineBrain Spinal CordSpleenTestisThymusTracheaHeart ValveMuscle Smooth00.511.52
log10(TPM+1)

Related Sequence

>RPL18P15
TGAAGAGGTTGTTTATGAGTGCACCAACCAGCCACCTCTGTCCCTTTCCCGGATGATCCCGAAAATGAAGCTTCCTGGCCAGGAAAACAAAACGGCCGTGGTTGTGGGAACCATAACAGATGACGTGTGGGTTCAGGAGGTGCCCAAACTGAAGGTGTGTGCACTGGGCGTGACCAGCCGGGCCCGCAGCCACATCTTCAGGGTGGGGGGCAAGAACCTCACTTTCGACCAGCTGGCCCTGGACTCCCCCAAGGTCTGCGGCACCGTCCTGCTCTCAGGTCCTCGCAAGGGTCGAGAGGTGTACTGGCATTTCGACAAGGCCCTGGGAACCCCACACAGCCACACCAAACCCTACGTCCGCTCCAAGGGCCGGAAGTTCGAGTATGCCAGAGGCCAAGGGGCCAGCCAAGGCTACAAAAACTAACCCTGGATCCTACC
>NM_001270490.2
CTCTTTCCGGACCTGGCCGAGCAGGAGGCGCCATCATGTTATACAGGTTTCTGGCCAGAAGAACCAACTCCACATTCAACCAGGTTGTGTTGAAGAGGTTGTTTATGAGTCGCACCAACCGGCCGCCTCTGTCCCTTTCCCGGATGATCCGGAAGATGAAGCTTCCTGGCCGGGAAAACAAGACGGCCGTGGTTGTGGGGACCATAACTGATGATGTGCGGGTTCAGGAGGTACCCAAACTGAAGGTATGTGCACTGCGCGTGACCAGCCGGGCCCGCAGCCGCATCCTCAGGGCAGGGGGCAAGATCCTCACTTTCGACCAGCTGGCCCTGGACTCCCCTAAGGGCTGTGGCACTGTCCTGCTCTCCGGTCCTCGCAAGGGCCGAGAGGTGTACCGGCATTTCGGCAAGGCCCCAGGAACCCCGCACAGCCACACCAAACCCTACGTCCGCTCCAAGGGCCGGAAGTTCGAGCGTGCCAGAGGCCGACGGGCCAGCCGAGGCTACAAAAACTAACCCTGGATCCTACTCTCTTATTAAAAAGATTTTTGCTGACA

Publications

PMID - Link Title
36244648HDLBP Promotes Hepatocellular Carcinoma Proliferation and Sorafenib Resistance by Suppressing Trim71-dependent RAF1 Degradation.
19123937Comparative analysis of processed ribosomal protein pseudogenes in four mammalian genomes.
12690205Human chromosome 7: DNA sequence and biology.