Retrocopy Name | RPL36AP68 |
|
Species | Homo sapiens | |
Coordinates (hg38) | chr7:149191045-149191256 UCSC | |
Coordinates (T2T) | chr7:150372861-150373072 UCSC | |
Coordinates (hg19) | chr7:148888137-148888348 UCSC | |
Strand | - | |
Parental Sequence | NM_021029.6 | |
Parental seq. overlap | 207 bp | |
Parental seq. overlap (%) | 27.2% | |
Genomic Region |
Intergenic |
|
Retrocopy Summary | RPL36AP68, located on chr7:149191045-149191256, is a retrocopy of the parental gene RPL36A. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
Gene Name | RPL36A |
Full Name | ribosomal protein L36a |
Also known as | L36A|L44L|MIG6|RPL44 |
Coordinate | chrX:101391011-101396155 |
Strand | + |
Gene summary | Cytoplasmic ribosomes, organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein, which shares sequence similarity with yeast ribosomal protein L44, belongs to the L44E (L36AE) family of ribosomal proteins. Although this gene has been referred to as ribosomal protein L44 (RPL44), its official name is ribosomal protein L36a (RPL36A). This gene and the human gene officially named ribosomal protein L36a-like (RPL36AL) encode nearly identical proteins; however, they are distinct genes. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Naturally occurring read-through transcription occurs between this locus and the heterogeneous nuclear ribonucleoprotein H2 (H') gene. [provided by RefSeq, Jan 2011] |
Species | Scientific Name | Retrocopy | |
![]() |
Chimpanzee | Pan troglodytes | RPL36AP13 |
![]() |
Bonobo | Pan paniscus | LOC100993427P13 |
![]() |
Gorilla | Gorilla gorilla | LOC101135216P15 |
![]() |
Orangutan | Pongo abelii | Without Homology |
![]() |
Gibbon | Nomascus leucogenys | Without Homology |
![]() |
Green monkey | Chlorocebus sabaeus | Without Homology |
![]() |
Crab-eating macaque | Macaca fascicularis | Without Homology |
![]() |
Rhesus | Macaca mulatta | Without Homology |
![]() |
Baboon | Papio anubis | Without Homology |
![]() |
Golden snub-nosed monkey | Rhinopithecus roxellana | Without Homology |
![]() |
Marmoset | Callithrix jacchus | Without Homology |
![]() |
Mouse lemur | Microcebus murinus | Without Homology |
![]() |
Mouse | Mus musculus | Without Homology |
![]() |
Rat | Rattus norvegicus | Without Homology |
![]() |
Chinese hamster | Cricetulus griseus | Without Homology |
![]() |
Rabbit | Oryctolagus cuniculus | Without Homology |
![]() |
Pig | Sus scrofa | Without Homology |
![]() |
Cow | Bos taurus | Without Homology |
![]() |
Sheep | Ovis aries | Without Homology |
![]() |
Dolphin | Tursiops truncatus | Without Homology |
![]() |
Horse | Equus caballus | Without Homology |
![]() |
Dog | Canis familiaris | Without Homology |
![]() |
Panda | Ailuropoda melanoleuca | Without Homology |
![]() |
Cat | Felis catus | Without Homology |
![]() |
Pale spear-nosed bat | Phyllostomus discolor | Without Homology |
![]() |
Velvety free-tailed bat | Molossus molossus | Without Homology |
![]() |
Greater mouse-eared bat | Myotis myotis | Without Homology |
![]() |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
![]() |
Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology |
![]() |
Egyptian rousette | Rousettus aegyptiacus | Without Homology |
![]() |
Sloth | Choloepus didactylus | Without Homology |
![]() |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
![]() |
Opossum | Monodelphis domestica | Without Homology |
![]() |
Platypus | Ornithorhynchus anatinus | Without Homology |
![]() |
Chicken | Gallus gallus | Without Homology |
![]() |
Turkey | Meleagris gallopavo | Without Homology |
![]() |
Zebra Finch | Taeniopygia guttata | Without Homology |
![]() |
Budgerigar | Melopsittacus undulatus | Without Homology |
![]() |
Painted Turtle | Chrysemys picta | Without Homology |
![]() |
Lizard | Anolis Carolinensis | Without Homology |
![]() |
Frog | Xenopus tropicalis | Without Homology |
![]() |
Zebrafish | Danio rerio | Without Homology |
![]() |
Drosophila | Drosophila melanogaster | Without Homology |
>RPL36AP68 |
CTTTCTTTCCGTGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGACGGACTTTCTGTAAGAAGTGTGGCAAGCACCAACCCCATAAAGTGACACAGTACAAGAAGGGCAAGGATTCTCTGCATGCCCAGGGAAAGCGGCGTTATGACAGGAAGCAGAGTGGCTATGGTGGGCAAACTAAGCCGATTTTCCGGAAAAAGGG |
>NM_021029.6 |
CTTTCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCCGGACTTTCTGTAAGAAGTGTGGCAAGCACCAACCCCATAAAGTGACACAGTACAAGAAGGGCAAGGATTCTCTGTACGCCCAGGGAAAGCGGCGTTATGACAGGAAGCAGAGTGGCTATGGTGGGCAAACTAAGCCGATTTTCCGGAAAAAGGCTAAAACTACAAAGAAGATTGTGCTAAGGCTTGAGTGCGTTGAGCCCAACTGCAGATCTAAGAGAATGCTGGCTATTAAAAGATGCAAGCATTTTGAACTGGGAGGAGATAAGAAGAGAAAGGGCCAAGTGATCCAGTTCTAAGTGTCATCTTTTATTATGAAGACAATAAAATCTTGAGTTTATGTTCACTTCATTTGTTTGCTGTTCATCTTTTGGGAGGGAATAAGCTAGAGCCATCAATACAATTCCGCTTGTGGGGAAATTTATGCCTCTTACTGGTACTACTTGTTTTGCATTGAAGCTGACTGGTTGAGTTCACATCATATGTTGCAATTTTCTAATTTGGCACTTCAATCACTAGGGGCCTTATGAGGCAGTTTGTCATTATGCAATGGTTATTGGTTATCATGTGAGTAGACACATTTCAGGCTAATAGGGAGAAGTCAGTAACACATTCATAGTGAATATGAGATGTCTTTGCTAAGAGTTAAGTGTCAGATCTTTGTTATAACAGTTAATTTAATAAAGAATTTTGGCATTGTTCTTCA |
PMID - Link | Title |
---|