Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Advanced Search

Summary

Retrocopy Name PDLIM7P1
Plot displaying the genomic locations of a retrocopy (in chr8) and its respective parental gene (in chr5). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr8:28238726-28239060  UCSC
Coordinates (T2T) chr8:28516952-28517286  UCSC
Coordinates (hg19) chr8:28096243-28096577  UCSC
Strand +
Parental Sequence NM_213636.3
Parental seq. overlap 289 bp
Parental seq. overlap (%) 28.7%
Genomic Region Intergenic
Retrocopy Summary PDLIM7P1, located on chr8:28238726-28239060, is a retrocopy of the parental gene PDLIM7. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name PDLIM7
Full Name PDZ and LIM domain 7
Also known as LMP1|LMP3
Coordinate chr5:177483394-177497604
Strand -
Gene summary The protein encoded by this gene is representative of a family of proteins composed of conserved PDZ and LIM domains. LIM domains are proposed to function in protein-protein recognition in a variety of contexts including gene transcription and development and in cytoskeletal interaction. The LIM domains of this protein bind to protein kinases, whereas the PDZ domain binds to actin filaments. The gene product is involved in the assembly of an actin filament-associated complex essential for transmission of ret/ptc2 mitogenic signaling. The biological function is likely to be that of an adapter, with the PDZ domain localizing the LIM-binding proteins to actin filaments of both skeletal muscle and nonmuscle tissues. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes PDLIM7P1
Bonobo Pan paniscus PDLIM7P1
Gorilla Gorilla gorilla PDLIM7P1
Orangutan Pongo abelii PDLIM7P1
Gibbon Nomascus leucogenys PDLIM7P1
Green monkey Chlorocebus sabaeus PDLIM7P1
Rhesus Macaca mulatta PDLIM7P1
Baboon Papio anubis PDLIM7P1
Golden snub-nosed monkey Rhinopithecus roxellana PDLIM7P1
Crab-eating macaque Macaca fascicularis Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>PDLIM7P1
TAGCAGAATGGACAGCTGCTCCAACTGCTGGTCCCAGATGCCACCAAGCAGTGGCTGATGGAGAACACCAAGGACTGGCCACCATGGTCTAGGACAGGCCAGTCACATTCCTTCAGCATCCTTGCCCACGTCATAGACACGGAGTTCATGCAAGACCTGGATGAGGAACACCTGAAGAAATCAAGGGAAAAGTATGTCCTGGGGCTATAGAGCCCATGCTGACCTGCCTCCAGGATTGGTACCACCAGCACTCTGCCCACATGCTCAATGTACAGTTGTAGCTTAGCCCTCTCCAGCTGGCTGCCCTGTCTACCTCTTTCTATTCCTTCTGCCCA
>NM_213636.3
GTCAGAACACTGGCGGCCGATCCCAACGAGGCTCCCTGGAGCCCGACGCAGAGCAGCGCCCTGGCCGGGCCAAGCAGGAGCCGGCATCATGGATTCCTTCAAAGTAGTGCTGGAGGGGCCAGCACCTTGGGGCTTCCGGCTGCAAGGGGGCAAGGACTTCAATGTGCCCCTCTCCATTTCCCGGCTCACTCCTGGGGGCAAAGCGGCGCAGGCCGGAGTGGCCGTGGGTGACTGGGTGCTGAGCATCGATGGCGAGAATGCGGGTAGCCTCACACACATCGAAGCTCAGAACAAGATCCGGGCCTGCGGGGAGCGCCTCAGCCTGGGCCTCAGCAGGGCCCAGCCGGTTCAGAGCAAACCGCAGAAGgcctCCGCCCCCGCCGCGGACCCTCCGCGGTACACCTTTGCACCCAGCGTCTCCCTCAACAAGACGGCCCGGCCCTTTGGGGCGCCCCCGCCCGCTGACAGCGCCCCGCAGCAGAATGGACAGCCGCTCCGACCGCTGGTCCCAGATGCCAGCAAGCAGCGGCTGATGGAGAACACAGAGGACTGGCGGCCGCGGCCGGGGACAGGCCAGTCGCGTTCCTTCCGCATCCTTGCCCACCTCACAGGCACCGAGTTCATGCAAGACCCGGATGAGGAGCACCTGAAGAAATCAAGGGAAAAGTATGTCCTGGAGCTGCAGAGCCCACGCTACACCCGCCTCCGGGACTGGCACCACCAGCGCTCTGCCCACGTGCTCAACGTGCAGTCGTAGCCCGGCCCTCTCCAGCCGGCTGCCCTCTCTGCCTCCCTCTTTCTGTTCCTCCTGCCCAGGGCACCCCCTTAGTGCCTCCAGCTTCTGCCTACCTCACCCCCCCTTTCGTGCCcctggcctgagcctcctgctggcctggccctggccGCCCACCTGGGTTCATCTGACACTGCCTTCCCTCTTTGCCCTGTGGTACTGCTGTCTGCCAGGTCTGTGCTGCCTTGGGCATGGAATAAACATTCTCAGCCCTG

Publications

PMID - Link Title