Retrocopy Name | RGS10P1 |
|
Species | Homo sapiens | |
Coordinates (hg38) | chr8:73831150-73831381 UCSC | |
Coordinates (T2T) | chr8:74260542-74260773 UCSC | |
Coordinates (hg19) | chr8:74743385-74743616 UCSC | |
Strand | + | |
Parental Sequence | NM_001005339.2 | |
Parental seq. overlap | 207 bp | |
Parental seq. overlap (%) | 22.3% | |
Genomic Region |
Intragenic (UBE2W) |
|
Retrocopy Summary | RGS10P1, located on chr8:73831150-73831381, is a retrocopy of the parental gene RGS10. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
Gene Name | RGS10 |
Full Name | regulator of G protein signaling 10 |
Also known as | - |
Coordinate | chr10:119499817-119542719 |
Strand | - |
Gene summary | Regulator of G protein signaling (RGS) family members are regulatory molecules that act as GTPase activating proteins (GAPs) for G alpha subunits of heterotrimeric G proteins. RGS proteins are able to deactivate G protein subunits of the Gi alpha, Go alpha and Gq alpha subtypes. They drive G proteins into their inactive GDP-bound forms. Regulator of G protein signaling 10 belongs to this family. All RGS proteins share a conserved 120-amino acid sequence termed the RGS domain. This protein associates specifically with the activated forms of the two related G-protein subunits, G-alphai3 and G-alphaz but fails to interact with the structurally and functionally distinct G-alpha subunits. Regulator of G protein signaling 10 protein is localized in the nucleus. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] |
Species | Scientific Name | Retrocopy | |
![]() |
Chimpanzee | Pan troglodytes | RGS10P1 |
![]() |
Bonobo | Pan paniscus | RGS10P1 |
![]() |
Gorilla | Gorilla gorilla | RGS10P1 |
![]() |
Orangutan | Pongo abelii | RGS10P1 |
![]() |
Gibbon | Nomascus leucogenys | RGS10P1 |
![]() |
Green monkey | Chlorocebus sabaeus | RGS10P1 |
![]() |
Crab-eating macaque | Macaca fascicularis | RGS10P1 |
![]() |
Rhesus | Macaca mulatta | RGS10P1 |
![]() |
Baboon | Papio anubis | RGS10P1 |
![]() |
Golden snub-nosed monkey | Rhinopithecus roxellana | RGS10P1 |
![]() |
Mouse lemur | Microcebus murinus | RGS10P1 |
![]() |
Marmoset | Callithrix jacchus | Without Homology |
![]() |
Mouse | Mus musculus | Without Homology |
![]() |
Rat | Rattus norvegicus | Without Homology |
![]() |
Chinese hamster | Cricetulus griseus | Without Homology |
![]() |
Rabbit | Oryctolagus cuniculus | Without Homology |
![]() |
Pig | Sus scrofa | Without Homology |
![]() |
Cow | Bos taurus | Without Homology |
![]() |
Sheep | Ovis aries | Without Homology |
![]() |
Dolphin | Tursiops truncatus | Without Homology |
![]() |
Horse | Equus caballus | Without Homology |
![]() |
Dog | Canis familiaris | Without Homology |
![]() |
Panda | Ailuropoda melanoleuca | Without Homology |
![]() |
Cat | Felis catus | Without Homology |
![]() |
Pale spear-nosed bat | Phyllostomus discolor | Without Homology |
![]() |
Velvety free-tailed bat | Molossus molossus | Without Homology |
![]() |
Greater mouse-eared bat | Myotis myotis | Without Homology |
![]() |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
![]() |
Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology |
![]() |
Egyptian rousette | Rousettus aegyptiacus | Without Homology |
![]() |
Sloth | Choloepus didactylus | Without Homology |
![]() |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
![]() |
Opossum | Monodelphis domestica | Without Homology |
![]() |
Platypus | Ornithorhynchus anatinus | Without Homology |
![]() |
Chicken | Gallus gallus | Without Homology |
![]() |
Turkey | Meleagris gallopavo | Without Homology |
![]() |
Zebra Finch | Taeniopygia guttata | Without Homology |
![]() |
Budgerigar | Melopsittacus undulatus | Without Homology |
![]() |
Painted Turtle | Chrysemys picta | Without Homology |
![]() |
Lizard | Anolis Carolinensis | Without Homology |
![]() |
Frog | Xenopus tropicalis | Without Homology |
![]() |
Zebrafish | Danio rerio | Without Homology |
![]() |
Drosophila | Drosophila melanogaster | Without Homology |
>RGS10P1 |
GGCAGCAGCCACCAGAGCCTCAAGAGCACAGCCAAATGGGTGGCTTTCCTGGAGAATCTGCTGGAAGACCTAGAAGGCATGAAAAGATTAAGGAAATTTTTTAAAAAGATATTCAATGAAGAAAATATTTTGTTTTGGCTAGCATGTAAAGATTTCTTTTTTTAATGCAAGATAAGCAGATGCAAGAAAAGGCAAAGGAGGTCTACATGACCTTTCTTTCCAGTAAGGCCTC |
>NM_001005339.2 |
ctcctcctcctcctcgccttcctccggctcagccgccgcgccgccgggctgctccttcttcctcctcGGGCGCCCGCGGCGATGTTCAACCGCGCCGTGAGCCGGCTGAGCAGGAAGCGGCCGCCGTCAGACATCCACGACAGCGATGGCAGTTCCAGCAGCAGCCACCAGAGCCTCAAGAGCACAGCCAAATGGGCGGCATCCCTGGAGAATCTGCTGGAAGACCCAGAAGGCGTGAAAAGATTTAGGGAATTTTTAAAAAAGGAATTCAGTGAAGAAAATGTTTTGTTTTGGCTAGCATGTGAAGATTTTAAGAAAATGCAAGATAAGACGCAGATGCAGGAAAAGGCAAAGGAGATCTACATGACCTTTCTGTCCAGCAAGGCCTCATCACAGGTCAACGTGGAGGGGCAGTCTCGGCTCAACGAGAAGATCCTGGAAGAACCGCACCCTCTGATGTTCCAGAAACTCCAGGACCAGATCTTTAATCTCATGAAGTACGACAGCTACAGCCGCTTCTTAAAGTCTGACTTGTTTTTAAAACACAAGCGAACCGAGGAAGAGGAAGAAGATTTGCCTGATGCTCAAACTGCAGCTAAAAGAGCTTCCAGAATTTATAACACATGAGCCCCCAAAAAGCCGGGACTGGCAGCTTTAAGAAGCAAAGGAATTTCCTCTCAGGACCGTGCCGGGTTTATCATTGCTTTGTTATTTGTAAGGACTGAAATGTACAAAACCCTTCAATGGGATGTGTGTTTTATTAACTGCTTCACCAGTAAATTTTGCATGATGGCTAAGCTAACATAAAAAAAGAATAATAATAACTTGGAAGTTTTAGTTTACAAAACAGAGATTCCTTCAACACTGGACACGTCGAGCATTTTGTAGCTTAATTAAACCTCATGTAAGGCCACAAGGTGAAA |
PMID - Link | Title |
---|