Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Advanced Search

Summary

Retrocopy Name ATP5PFP3
Plot displaying the genomic locations of a retrocopy (in chr8) and its respective parental gene (in chr21). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr8:98633501-98634008  UCSC
Coordinates (T2T) chr8:99758631-99759138  UCSC
Coordinates (hg19) chr8:99645729-99646236  UCSC
Strand +
Parental Sequence NM_001003703.2
Parental seq. overlap 456 bp
Parental seq. overlap (%) 85.2%
Genomic Region Intragenic (STK3)
Intragenic (STK24)
Retrocopy Summary ATP5PFP3, located on chr8:98633501-98634008, is a retrocopy of the parental gene ATP5PF. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name ATP5PF
Full Name ATP synthase peripheral stalk subunit F6
Also known as ATP5|ATP5A|ATP5J|ATPM|CF6|F6
Coordinate chr21:25724500-25735653
Strand -
Gene summary Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. It is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, which comprises the proton channel. The F1 complex consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled in a ratio of 3 alpha, 3 beta, and a single representative of the other 3. The Fo complex has nine subunits (a, b, c, d, e, f, g, F6 and 8). This gene encodes the F6 subunit of the Fo complex. The F6 subunit is required for F1 and Fo interactions. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. This gene has 1 or more pseudogenes. [provided by RefSeq, Feb 2016]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes ATP5PFP2
Bonobo Pan paniscus ATP5PFP2
Gorilla Gorilla gorilla ATP5PFP1
Orangutan Pongo abelii ATP5PFP2
Gibbon Nomascus leucogenys ATP5PFP2
Green monkey Chlorocebus sabaeus ATP5JP2
Crab-eating macaque Macaca fascicularis ATP5JP2
Rhesus Macaca mulatta ATP5PFP2
Baboon Papio anubis ATP5PFP2
Golden snub-nosed monkey Rhinopithecus roxellana ATP5PFP2
Marmoset Callithrix jacchus ATP5PFP4
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>ATP5PFP3
TGGCTTTGCCAGCTCAGGACTGAGTGCAAGTAACAGAGAATCAGCCAGATTCTCCAGAGGCTCTTCAGGTTCTCCTCTGTCTTTCAGTCAGCAGTCTCAGTCCATTTGCGGAGGAACATTGGTGTTACAGCAGTGGCGTTTAATAAGGAACTTGATCCTGTACAGAAACTCTTTATGTACAAGGTTAGAGAATACAAATCTAAGTGACAGACATCTGGAGGATCTGTTGATACTGATCCAGAGTACCAGCAAGAGCCAGAGAAGAAGCTTTTTAAGCTCAAGCAAGTGTATGGTAAAGCAGACATGAATACATTCCCTAACTTCAAATTTGAAGATCCCAAACTTGAAGTCATCAAAAAACCCCAGGCCTGAAGAAATAAAGTAAAATTAACCTGGTAAGTTGTCAAGGGTTAGCTGTACAACTAGCTAGAAGTTTCAGAATAAACATACATTCACAACTGTCAAATGTTCTTTTAATCTCGATTCCAAATAAATTAGTTGGTGATGT
>NM_001003703.2
AGAGCGGAGGTGGTGGCGGCGGAGGCTTTGGCAGCTCGGGACTGAGTGCAAGAATCAGCATGATTCTTCAGAGGCTCTTCAGGTTCTCCTCTGTCATTCGGTCAGCCGTCTCAGTCCATTTGCGGAGGAACATTGGTGTTACAGCAGTGGCATTTAATAAGGAACTTGATCCTATACAGAAACTCTTTGTGGACAAGATTAGAGAATACAAATCTAAGCGACAGACATCTGGAGGACCTGTTGATGCTAGTTCAGAGTATCAGCAAGAGCTGGAGAGGGAGCTTTTTAAGCTCAAGCAAATGTTTGGTAATGCAGACATGAATACATTTCCCACCTTCAAATTTGAAGATCCCAAATTTGAAGTCATCGAAAAACCCCAGGCCTGAAGAAATAAAGTAAAATTAATCTGGTAATTTGTCACGGATTAGTTGTACAACTAGTTAGAAGTTTCAGAATAAACATGCATTTCATAACTGTCAAATGTTCTTTTAATTCTGAGTCCAAATAAATTATTTGGTGATGTTGA

Publications

PMID - Link Title