Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name RPS29P36
Wait
Plot displaying the genomic locations of a retrocopy (in chr9) and its respective parental gene (in chr14). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr9:87525271-87525564  UCSC
Coordinates (T2T) chr9:99678734-99679027  UCSC
Coordinates (hg19) chr9:90140186-90140479  UCSC
Strand +
Parental Sequence NM_001032.5
Parental seq. overlap 279 bp
Parental seq. overlap (%) 93.6%
Genomic Region Intragenic (DAPK1)
Retrocopy Summary RPS29P36, located on chr9:87525271-87525564, is a retrocopy of the parental gene RPS29. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name RPS29
Full Name ribosomal protein S29
Also known as DBA13|S29|uS14
Coordinate chr14:49570988-49598710
Strand -
Gene summary Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit and a member of the S14P family of ribosomal proteins. The protein, which contains a C2-C2 zinc finger-like domain that can bind to zinc, can enhance the tumor suppressor activity of Ras-related protein 1A (KREV1). It is located in the cytoplasm. Variable expression of this gene in colorectal cancers compared to adjacent normal tissues has been observed, although no correlation between the level of expression and the severity of the disease has been found. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2013]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes RPS29P18
Bonobo Pan paniscus RPS29P18
Gorilla Gorilla gorilla RPS29P21
Orangutan Pongo abelii RPS29P19
Gibbon Nomascus leucogenys Without Homology
Green monkey Chlorocebus sabaeus Without Homology
Crab-eating macaque Macaca fascicularis Without Homology
Rhesus Macaca mulatta Without Homology
Baboon Papio anubis Without Homology
Golden snub-nosed monkey Rhinopithecus roxellana Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

The Genotype-Tissue Expression project - (GTEx)

Related Sequence

>RPS29P36
GCTTTTACCTCGTTGCACTCCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCACCCGCGAAAATTCGGCCAGGGTTCTCGCTCTTGTTGCGTGTGTTCAAACAACCGGCACGGTCTGATCCGGAAATATGGCCTCAATATGTGCCGCCAGTGTTTCCGTCAGTACGCGAAGGATATCGGTTTCATTAAGTTGGACTAAATGATCTTCCTTCAAAGGATTATCCAAGGCATATACTCAATGAAAAACCATGATAGTTCTTTGTACATAAAATAAACATTTGAAAAAAC
>NM_001032.5
CTTCCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCACCCGCGAAAATTCGGCCAGGGTTCTCGCTCTTGTCGTGTCTGTTCAAACCGGCACGGTCTGATCCGGAAATATGGCCTCAATATGTGCCGCCAGTGTTTCCGTCAGTACGCGAAGGATATCGGTTTCATTAAGTTGGACTAAATGCTCTTCCTTCAGAGGATTATCCGGGGCATCTACTCAATGAAAAACCATGATAATTCTTTGTATATAAAATAAACATTTGAAAAAACC

Publications

PMID - Link Title
No publications available for this retrocopy