Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Advanced Search

Summary

Retrocopy Name PYY3
Plot displaying the genomic locations of a retrocopy (in chrX) and its respective parental gene (in chr17). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chrX:50156065-50156338  UCSC
Coordinates (T2T) chrX:49473717-49473990  UCSC
Coordinates (hg19) chrX:49920713-49920986  UCSC
Strand +
Parental Sequence NM_004160.6
Parental seq. overlap 235 bp
Parental seq. overlap (%) 22.7%
Genomic Region Intergenic
Retrocopy Summary PYY3, located on chrX:50156065-50156338, is a retrocopy of the parental gene PYY. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name PYY
Full Name peptide YY
Also known as PYY-I|PYY1
Coordinate chr17:43952733-44004445
Strand -
Gene summary This gene encodes a member of the neuropeptide Y (NPY) family of peptides. The encoded preproprotein is proteolytically processed to generate two alternative peptide products that differ in length by three amino acids. These peptides, secreted by endocrine cells in the gut, exhibit different binding affinities for each of the neuropeptide Y receptors. Binding of the encoded peptides to these receptors mediates regulation of pancreatic secretion, gut mobility and energy homeostasis. Rare variations in this gene could increase susceptibility to obesity and elevated serum levels of the encoded peptides may be associated with anorexia nervosa. [provided by RefSeq, Feb 2016]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes PYYP1
Bonobo Pan paniscus PYYP1
Gorilla Gorilla gorilla PYYP1
Orangutan Pongo abelii PYYP1
Gibbon Nomascus leucogenys Without Homology
Green monkey Chlorocebus sabaeus Without Homology
Crab-eating macaque Macaca fascicularis Without Homology
Rhesus Macaca mulatta Without Homology
Baboon Papio anubis Without Homology
Golden snub-nosed monkey Rhinopithecus roxellana Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>PYY3
TGCAGAGGAGGCTTCAGGTCGACCTGTGGCAGTCCAGCCCTTGGGGGTTCCCTCGCCTTCCACCTCCTGCTCATCTGCTTCACTAGCTATCCCTATGGTGTCGGTGTGCAGGCCGTGGCCTGCTGTGGCCATAGCACTTCTGGCTCTGCTGGTCTGCCTGGGGGCGCTGGTCGACACCTGCCCCATCAAACCCGAGGCTCCTGGCGAAGACGAGTCCCTGGAGGAGCTGAGCCACTATTATGCTTCCCTGTGCCACTACCTCAACGTGGTCACC
>NM_004160.6
ATCGGTCATGGGGCCGAGACTAAATGTGGCGGGTTGTCTTTAATCTGCTGCCAAGAGGAAACTCATTCAGGCAAGTTCAGCCCTTTATGAGGAATTCCCCTGTGGTCACATTCCAATTCCTGGACCTGCTGCCACCCTCAGAACTGCATGCTCCTTCTTCAGACTTTCTAAGAATGACTCAGGTCATTGGTGGAGTGAAGTCAAGATTTCCAACTCAGTCACCTGAAGAGATGGAGATACCATTCATGGAGCTGGAGGTCCCTGGAGATTTGGGAATTCAGATAACAAGCTAAGATAAGGagtttgcctacctctgTCCTAGAGCGAAGCCTGAGCCTTGGGCGCGCAGCACACCACAAGTATCTGTTACTGTGTTTTGCAGAAGCTTCAGGCGGGGATATAAGCCCCACAAGGAAAGCGCTGAGCAGAGGAGGCCTCAGCTTGACCTGCGGCAGTGCAGCCCTTGGGACTTCCCTCGCCTTCCACCTCCTGCTCGTCTGCTTCACAAGCTATCGCTATGGTGTTCGTGCGCAGGCCGTGGCCCGCCTTGACCACAGTGCTTCTGGCCCTGCTCGTCTGCCTAGGGGCGCTGGTCGACGCCTACCCCATCAAACCCGAGGCTCCCCGCGAAGACGCCTCGCCGGAGGAGCTGAACCGCTACTACGCCTCCCTGCGCCACTACCTCAACCTGGTCACCCGGCAGCGGTATGGGAAAAGAGACGGCCCGGACACGCTTCTTTCCAAAACGTTCTTCCCCGACGGCGAGGACCGCCCCGTCAGGTCGCGGTCGGAGGGCCCAGACCTGTGGTGAGGACCCCTGAGGCCTCCTGGGAGATCTGCCAACCACGCCCACGTCATTTGCATACGCACTCCCGACCCCAGAAACCCGGATTCTGCCTCCCGACGGCGGCGTCTGGGCAGGGTTCGGGTGCGGCCCTCCGCCCGCGTCTCGGTGCCCCCGCCCCCTGGGCTGGAGGGCTGTGTGTGGTCCTTCCCTGGTCCCAAAATAAAGAGCAAATTCCACAGAAACGGAA

Publications

PMID - Link Title