Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Advanced Search

Summary

Retrocopy Name Fth1P6
Wait
Plot displaying the genomic locations of a retrocopy (in chr18) and its respective parental gene (in chr1). Each line represents a retrocopy.
Species Rattus norvegicus
Coordinates chr18:47294721-47294885  UCSC
Strand +
Parental Sequence NM_012848.2
Parental seq. overlap 130 bp
Parental seq. overlap (%) 15.7%
Genomic Region Intergenic
Retrocopy Summary Fth1P6, located on chr18:47294721-47294885, is a retrocopy of the parental gene Fth1. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name Fth1
Full Name ferritin heavy chain 1
Also known as Fth
Coordinate chr1:226030940-226033228
Strand +
Gene summary Predicted to enable ferric iron binding activity and ferrous iron binding activity. Involved in negative regulation of fibroblast proliferation and negative regulation of necrotic cell death. Predicted to be located in autolysosome. Predicted to be active in cytoplasm. Biomarker of congestive heart failure and hepatocellular carcinoma. Human ortholog(s) of this gene implicated in hemochromatosis type 5. Orthologous to human FTH1 (ferritin heavy chain 1). [provided by Alliance of Genome Resources, Apr 2022]

Homology

Species Scientific Name Retrocopy
Human Homo sapiens FTMT
Chimpanzee Pan troglodytes FTH1P11
Bonobo Pan paniscus FTH1P11
Gorilla Gorilla gorilla FTH1P11
Orangutan Pongo abelii FTH1P10
Gibbon Nomascus leucogenys FTH1P3
Green monkey Chlorocebus sabaeus FTH1P13
Crab-eating macaque Macaca fascicularis FTH1P7
Rhesus Macaca mulatta FTH1P7
Baboon Papio anubis FTH1P4
Golden snub-nosed monkey Rhinopithecus roxellana FTH1P6
Marmoset Callithrix jacchus FTH1P6
Mouse lemur Microcebus murinus FTH1P5
Mouse Mus musculus Fth1P3
Chinese hamster Cricetulus griseus Fth1_1P1
Dolphin Tursiops truncatus FTH1P6
Panda Ailuropoda melanoleuca FTH1P2
Cat Felis catus FTH1P1
Sloth Choloepus didactylus FTH1P75
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

This retrocopy transcript is not present in the database for expression quantification

Related Sequence

>Fth1P6
GGAGAGGGAGCATGCAGAGAAGCTTATGAGACTGCAGAACCAGCGAGGAGGCCGGATCTGCCTCCAGGACATCAAGAAGCCAGACAAAGATGACTGGGAATGCGGACTGCGGGCCATGGAATGTGCCTTGCTCTTAGAAAAGAGTGTAAACCAGTCCCTCCTGGA
>NM_012848.2
ACAGTGCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTTGAGCCTGAGCCCTTTGCAACTTCGTCGCTCCGCCGCTCCAGCGTCGCCTCCGCGCCTCGCCCAGCCGCCATCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACTCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCCATGTCTTGTTATTTTGACCGGGATGATGTGGCCCTGAAGAACTTTGCCAAATACTTTCTCCATCAATCTCATGAAGAGAGGGAACATGCTGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGACGAATCTTCCTGCAGGATATAAAGAAACCTGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTTCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGCATTACCTGAATGAGCAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGAGCCCCTGAATCTGGCATGGCAGAATATCTCTTTGACAAGCACACCCTGGGACACGGTGATGAGAGCTAAGCTGACGTCCCCAAGGCCATGTGACTTTACTGGTCACTGAGGCAGTGCATGCATGTCAGGCTGCCTTTATCTTTTCTATAAGTTGCACCAAAACATCTGCTTAAAAGTTCTTTAATTTGTACCATTTCTTCAAATAAAGAATTTTGGTACCC

Publications

PMID - Link Title
No publications available for this retrocopy