| Retrocopy Name | Fth1P6 |
|
| Species | Rattus norvegicus | |
| Coordinates | chr18:47294721-47294885 UCSC | |
| Strand | + | |
| Parental Sequence | NM_012848.2 | |
| Parental seq. overlap | 130 bp | |
| Parental seq. overlap (%) | 15.7% | |
| Genomic Region |
Intergenic |
|
| Retrocopy Summary | Fth1P6, located on chr18:47294721-47294885, is a retrocopy of the parental gene Fth1. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
| Gene Name | Fth1 |
| Full Name | ferritin heavy chain 1 |
| Also known as | Fth |
| Coordinate | chr1:226030940-226033228 |
| Strand | + |
| Gene summary | Predicted to enable ferric iron binding activity and ferrous iron binding activity. Involved in negative regulation of fibroblast proliferation and negative regulation of necrotic cell death. Predicted to be located in autolysosome. Predicted to be active in cytoplasm. Biomarker of congestive heart failure and hepatocellular carcinoma. Human ortholog(s) of this gene implicated in hemochromatosis type 5. Orthologous to human FTH1 (ferritin heavy chain 1). [provided by Alliance of Genome Resources, Apr 2022] |
| Species | Scientific Name | Retrocopy | |
![]() |
Human | Homo sapiens | FTMT |
![]() |
Chimpanzee | Pan troglodytes | FTH1P11 |
![]() |
Bonobo | Pan paniscus | FTH1P11 |
![]() |
Gorilla | Gorilla gorilla | FTH1P11 |
![]() |
Orangutan | Pongo abelii | FTH1P10 |
![]() |
Gibbon | Nomascus leucogenys | FTH1P3 |
![]() |
Green monkey | Chlorocebus sabaeus | FTH1P13 |
![]() |
Crab-eating macaque | Macaca fascicularis | FTH1P7 |
![]() |
Rhesus | Macaca mulatta | FTH1P7 |
![]() |
Baboon | Papio anubis | FTH1P4 |
![]() |
Golden snub-nosed monkey | Rhinopithecus roxellana | FTH1P6 |
![]() |
Marmoset | Callithrix jacchus | FTH1P6 |
![]() |
Mouse lemur | Microcebus murinus | FTH1P5 |
![]() |
Mouse | Mus musculus | Fth1P3 |
![]() |
Chinese hamster | Cricetulus griseus | Fth1_1P1 |
![]() |
Dolphin | Tursiops truncatus | FTH1P6 |
![]() |
Panda | Ailuropoda melanoleuca | FTH1P2 |
![]() |
Cat | Felis catus | FTH1P1 |
![]() |
Sloth | Choloepus didactylus | FTH1P75 |
![]() |
Rabbit | Oryctolagus cuniculus | Without Homology |
![]() |
Pig | Sus scrofa | Without Homology |
![]() |
Cow | Bos taurus | Without Homology |
![]() |
Sheep | Ovis aries | Without Homology |
![]() |
Horse | Equus caballus | Without Homology |
![]() |
Dog | Canis familiaris | Without Homology |
![]() |
Pale spear-nosed bat | Phyllostomus discolor | Without Homology |
![]() |
Velvety free-tailed bat | Molossus molossus | Without Homology |
![]() |
Greater mouse-eared bat | Myotis myotis | Without Homology |
![]() |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
![]() |
Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology |
![]() |
Egyptian rousette | Rousettus aegyptiacus | Without Homology |
![]() |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
![]() |
Opossum | Monodelphis domestica | Without Homology |
![]() |
Platypus | Ornithorhynchus anatinus | Without Homology |
![]() |
Chicken | Gallus gallus | Without Homology |
![]() |
Turkey | Meleagris gallopavo | Without Homology |
![]() |
Zebra Finch | Taeniopygia guttata | Without Homology |
![]() |
Budgerigar | Melopsittacus undulatus | Without Homology |
![]() |
Painted Turtle | Chrysemys picta | Without Homology |
![]() |
Lizard | Anolis Carolinensis | Without Homology |
![]() |
Frog | Xenopus tropicalis | Without Homology |
![]() |
Zebrafish | Danio rerio | Without Homology |
![]() |
Drosophila | Drosophila melanogaster | Without Homology |
| >Fth1P6 |
| GGAGAGGGAGCATGCAGAGAAGCTTATGAGACTGCAGAACCAGCGAGGAGGCCGGATCTGCCTCCAGGACATCAAGAAGCCAGACAAAGATGACTGGGAATGCGGACTGCGGGCCATGGAATGTGCCTTGCTCTTAGAAAAGAGTGTAAACCAGTCCCTCCTGGA |
| >NM_012848.2 |
| ACAGTGCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTTGAGCCTGAGCCCTTTGCAACTTCGTCGCTCCGCCGCTCCAGCGTCGCCTCCGCGCCTCGCCCAGCCGCCATCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACTCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCCATGTCTTGTTATTTTGACCGGGATGATGTGGCCCTGAAGAACTTTGCCAAATACTTTCTCCATCAATCTCATGAAGAGAGGGAACATGCTGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGACGAATCTTCCTGCAGGATATAAAGAAACCTGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTTCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGCATTACCTGAATGAGCAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGAGCCCCTGAATCTGGCATGGCAGAATATCTCTTTGACAAGCACACCCTGGGACACGGTGATGAGAGCTAAGCTGACGTCCCCAAGGCCATGTGACTTTACTGGTCACTGAGGCAGTGCATGCATGTCAGGCTGCCTTTATCTTTTCTATAAGTTGCACCAAAACATCTGCTTAAAAGTTCTTTAATTTGTACCATTTCTTCAAATAAAGAATTTTGGTACCC |
| PMID - Link | Title |
|---|