Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name UBA52P4
Plot displaying the genomic locations of a retrocopy (in chr17) and its respective parental gene (in chr7). Each line represents a retrocopy.
Species Bos taurus
Coordinates chr17:50888540-50888749  UCSC
Strand +
Parental Sequence NM_001076363.2
Parental seq. overlap 178 bp
Parental seq. overlap (%) 33.9%
Genomic Region Intragenic (UBC)
Retrocopy Summary UBA52P4, located on chr17:50888540-50888749, is a retrocopy of the parental gene UBA52. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name UBA52
Full Name ubiquitin A-52 residue ribosomal protein fusion product 1
Also known as RPS27A|UBB|UBC
Coordinate chr7:4603744-4606128
Strand -
Gene summary N/A

Homology

Species Scientific Name Retrocopy
Human Homo sapiens UBA52P13
Chimpanzee Pan troglodytes UBA52P7
Bonobo Pan paniscus UBA52P9
Gorilla Gorilla gorilla UBA52P8
Gibbon Nomascus leucogenys UBA52P9
Green monkey Chlorocebus sabaeus UBBP3
Crab-eating macaque Macaca fascicularis UBA52P10
Baboon Papio anubis UBA52P9
Golden snub-nosed monkey Rhinopithecus roxellana UBA52P10
Marmoset Callithrix jacchus UBA52P16
Pig Sus scrofa UBA52P3
Sheep Ovis aries UBA52P7
Dolphin Tursiops truncatus UBBP7
Dog Canis familiaris RPS27AP8
Cat Felis catus UBA52P13
Pale spear-nosed bat Phyllostomus discolor UBA52P39
Velvety free-tailed bat Molossus molossus RPS27AP23
Greater horseshoe bat Rhinolophus ferrumequinum UBA52P23
Egyptian rousette Rousettus aegyptiacus RPS27AP5
Sloth Choloepus didactylus UBA52P13
Orangutan Pongo abelii Without Homology
Rhesus Macaca mulatta Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Horse Equus caballus Without Homology
Panda Ailuropoda melanoleuca Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>UBA52P4
AATGCAGATCTTTGTGAAGACCCTCACTGGTAAAACCATCACTCTGGAGGTGGAGCCCAGTGACACCATCGAGAACGTCAAGGGGAAGATACAAGAAAAAGAAGGCATCCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAACAGCTGGAAGATGGCCGCACCCTGTCTGACTACAACATCCAGAAGGAGTCCACTCTGCACCTGGT
>NM_001076363.2
CTCTTCAACCAGGCGGCCGAGCAGCAGGCGCAGAGATGCAGATCTTTGTGAAGACCCTGACGGGCAAGACCATCACCCTTGAGGTCGAGCCCAGTGACACCATTGAGAATGTCAAAGCCAAAATCCAAGACAAGGAGGGCATCCCACCTGACCAGCAGCGGCTGATCTTCGCTGGCAAACAGCTGGAGGATGGCCGCACTCTGTCAGATTACAATATCCAGAAAGAGTCCACCCTGCACTTGGTGCTTCGTCTGCGAGGCGGCATCATCGAGCCTTCCCTCCGCCAGCTCGCTCAGAAATACAACTGCGACAAGATGATCTGCCGCAAGTGTTACGCCCGCCTGCACCCCCGTGCTGTCAACTGCCGCAAGAAGAAGTGTGGCCACACCAACAACCTGCGCCCCAAGAAGAAGGTCAAATAAAGCTCTTCCACCTGCTTCTCCTTTGCCCGCAGGGCGGCCTCCTGCCCAAGCCCCGTGGTCCTGGGCCTCAATAAAGTTTCCCTTTCGTTGACTGGAGCAGTAA

Publications

PMID - Link Title