Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Advanced Search

Summary

Retrocopy Name UBA52P13
Plot displaying the genomic locations of a retrocopy (in chrD3) and its respective parental gene (in chrA2). Each line represents a retrocopy.
Species Felis catus
Coordinates chrD3:5400244-5400446  UCSC
Strand +
Parental Sequence NM_001123354.1
Parental seq. overlap 176 bp
Parental seq. overlap (%) 36.7%
Genomic Region Intragenic (UBC)
Retrocopy Summary UBA52P13, located on chrD3:5400244-5400446, is a retrocopy of the parental gene UBA52. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name UBA52
Full Name ubiquitin A-52 residue ribosomal protein fusion product 1
Also known as CEP52|UBCEP2
Coordinate chrA2:13744570-13747831
Strand +
Gene summary Ubiquitin is synthesized as a precursor protein consisting of either polyubiquitin chains or a single ubiquitin moiety fused to an unrelated protein. This gene encodes a fusion protein consisting of ubiquitin at the N-terminus and ribosomal protein L40 at the C-terminus, a C-terminal extension protein (CEP). [provided by RefSeq, Jun 2010]

Homology

Species Scientific Name Retrocopy
Human Homo sapiens UBA52P13
Chimpanzee Pan troglodytes UBA52P7
Bonobo Pan paniscus UBA52P9
Gorilla Gorilla gorilla UBA52P8
Orangutan Pongo abelii RPS27AP16
Gibbon Nomascus leucogenys UBA52P9
Crab-eating macaque Macaca fascicularis UBA52P10
Baboon Papio anubis UBA52P9
Golden snub-nosed monkey Rhinopithecus roxellana UBA52P10
Pig Sus scrofa RPS27AP9
Cow Bos taurus UBA52P4
Sheep Ovis aries UBA52P7
Dolphin Tursiops truncatus UBBP7
Dog Canis familiaris RPS27AP8
Pale spear-nosed bat Phyllostomus discolor UBA52P39
Velvety free-tailed bat Molossus molossus RPS27AP23
Greater horseshoe bat Rhinolophus ferrumequinum UBA52P23
Egyptian rousette Rousettus aegyptiacus RPS27AP5
Sloth Choloepus didactylus UBA52P13
Green monkey Chlorocebus sabaeus Without Homology
Rhesus Macaca mulatta Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Horse Equus caballus Without Homology
Panda Ailuropoda melanoleuca Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>UBA52P13
CATGCAGATCTTCGTGAAGACCTTGACGGGTAAGACCATCACCCTGGAGGTAGAGCCCAGTGACACCATCGAGAATGTCAAAGGGAAGATCCAGGAAAAAGAGGGCATCCCCCCTGACCAGCAGAGGTTGATCTTTGCCGGAAACAGCTGGAAGATGGCGCACCCTGTCTGACTACAACATCCAGAAGGAGTCCACTCTGCAC
>NM_001123354.1
ATGCAGATCTTTGTGAAGACCCTAACGGGCAAGACCATCACCCTCGAGGTTGAGCCCAGTGACACCATTGAGAATGTCAAAGCCAAAATCCAAGACAAGGAGGGCATCCCTCCTGACCAGCAGCGTCTGATTTTCGCGGGCAAACAGCTGGAAGACGGCCGCACTCTGTCAGACTACAATATCCAGAAAGAGTCCACCCTGCACTTGGTGCTTCGCCTGCGGGGTGGCATCATTGAGCCTTCCCTCCGCCAGCTGGCCCAGAAATACAACTGCGACAAGATGATCTGCCGCAAGTGTTACGCTCGCCTGCACCCCCGTGCAGTCAACTGCCGCAAGAAGAAGTGCGGCCACACCAACAACCTGCGCCCCAAGAAGAAGGTCAAATAAGGCCCCTCCACCGGCTCTTCTTTGCCTGCAGGACGGCCTCCTGCCCAAGCCCCAAGGCCCTGGGGCCTCAATAAAGTTTCCCTTTCATTGA

Publications

PMID - Link Title