| Retrocopy Name | UBA52P13 |
|
| Species | Ailuropoda melanoleuca | |
| Coordinates | chr12:4708947-4709157 UCSC | |
| Strand | + | |
| Parental Sequence | NM_001304907.1 | |
| Parental seq. overlap | 180 bp | |
| Parental seq. overlap (%) | 44.4% | |
| Genomic Region |
Intergenic |
|
| Retrocopy Summary | UBA52P13, located on chr12:4708947-4709157, is a retrocopy of the parental gene UBA52. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
| Gene Name | UBA52 |
| Full Name | N/A |
| Also known as | RPL40 |
| Coordinate | chr4:13550397-13553909 |
| Strand | + |
| Gene summary | N/A |
| Species | Scientific Name | Retrocopy | |
 |
Human | Homo sapiens | UBA52P13 |
 |
Chimpanzee | Pan troglodytes | UBA52P7 |
 |
Bonobo | Pan paniscus | UBA52P9 |
 |
Gorilla | Gorilla gorilla | UBA52P8 |
 |
Orangutan | Pongo abelii | RPS27AP16 |
 |
Gibbon | Nomascus leucogenys | UBA52P9 |
 |
Green monkey | Chlorocebus sabaeus | UBBP3 |
 |
Crab-eating macaque | Macaca fascicularis | UBA52P10 |
 |
Baboon | Papio anubis | UBA52P9 |
 |
Golden snub-nosed monkey | Rhinopithecus roxellana | UBA52P10 |
 |
Marmoset | Callithrix jacchus | UBA52P16 |
 |
Mouse lemur | Microcebus murinus | UBA52P10 |
 |
Pig | Sus scrofa | RPS27AP9 |
 |
Sheep | Ovis aries | UBA52P7 |
 |
Dolphin | Tursiops truncatus | UBBP7 |
 |
Horse | Equus caballus | UBA52P4 |
 |
Dog | Canis familiaris | RPS27AP8 |
 |
Pale spear-nosed bat | Phyllostomus discolor | UBA52P39 |
 |
Greater horseshoe bat | Rhinolophus ferrumequinum | UBA52P23 |
 |
Egyptian rousette | Rousettus aegyptiacus | RPS27AP5 |
 |
Sloth | Choloepus didactylus | UBA52P13 |
 |
Rhesus | Macaca mulatta | Without Homology |
 |
Mouse | Mus musculus | Without Homology |
 |
Rat | Rattus norvegicus | Without Homology |
 |
Chinese hamster | Cricetulus griseus | Without Homology |
 |
Rabbit | Oryctolagus cuniculus | Without Homology |
 |
Cow | Bos taurus | Without Homology |
 |
Cat | Felis catus | Without Homology |
 |
Velvety free-tailed bat | Molossus molossus | Without Homology |
 |
Greater mouse-eared bat | Myotis myotis | Without Homology |
 |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
 |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
 |
Opossum | Monodelphis domestica | Without Homology |
 |
Platypus | Ornithorhynchus anatinus | Without Homology |
 |
Chicken | Gallus gallus | Without Homology |
 |
Turkey | Meleagris gallopavo | Without Homology |
 |
Zebra Finch | Taeniopygia guttata | Without Homology |
 |
Budgerigar | Melopsittacus undulatus | Without Homology |
 |
Painted Turtle | Chrysemys picta | Without Homology |
 |
Lizard | Anolis Carolinensis | Without Homology |
 |
Frog | Xenopus tropicalis | Without Homology |
 |
Zebrafish | Danio rerio | Without Homology |
 |
Drosophila | Drosophila melanogaster | Without Homology |
| >UBA52P13 |
| AATGCAGATCTTCGTGAAGACCTTTGACCGGTAAGACCATCACCCTGGAGGTGGAGCCCAGCGACACCATCGAGAATGTCAAGGCGAAGATCCAGGACAAGGAGGGCATCCCCCCGGACCAGCAGAGGTTGATCTTTGCCGGGAAACAGCTGGAAGATGGGCGCACCCTGTCTGACTACAACATCCAGAAGGAATCCACTCTGCACTTGGT |
| >NM_001304907.1 |
| CAGCAGACGCAGAGATGCAGATCTTTGTGAAGACCCTGACGGGCAAGACCATCACCCTTGAGGTCGAGCCCAGTGACACCATTGAGAATGTCAAAGCCAAAATCCAAGACAAGGAGGGCATCCCGCCTGACCAACAGCGTCTGATTTTTGCGGGCAAACAGCTGGAAGATGGCCGCACTCTGTCAGACTACAATATCCAGAAAGAGTCCACCCTACACTTGGTGCTTCGCCTCCGGGGTGGCATCATCGAGCCTTCCCTCCGCCAGCTGGCCCAGAAGTACAACTGCGACAAGATGATCTGCCGCAAGTGTTATGCTCGCCTGCACCCCCGCGCCGTCAACTGCCGCAAGAAGAAGTGCGGCCACACCAACAACCTGCGCCCCAAAAAGAAGGTCAAATAAGGC |
| PMID - Link | Title |
|---|