| Retrocopy Name | SUMO2P3 |
|
| Species | Rousettus aegyptiacus | |
| Coordinates | scaffold_m13_p_8:66932086-66932297 UCSC | |
| Strand | - | |
| Parental Sequence | SUMO2_x1 | |
| Parental seq. overlap | 181 bp | |
| Parental seq. overlap (%) | 62% | |
| Genomic Region |
Intergenic |
|
| Retrocopy Summary | SUMO2P3, located on scaffold_m13_p_8:66932086-66932297, is a retrocopy of the parental gene SUMO2. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
| Gene Name | SUMO2 |
| Full Name | N/A |
| Also known as | NULL |
| Coordinate | scaffold_m13_p_6:111077856-111086784 |
| Strand | - |
| Gene summary | N/A |
| Species | Scientific Name | Retrocopy | |
 |
Human | Homo sapiens | SUMO2P25 |
 |
Chimpanzee | Pan troglodytes | SUMO2P6 |
 |
Bonobo | Pan paniscus | SUMO2P7 |
 |
Gorilla | Gorilla gorilla | SUMO2P25 |
 |
Orangutan | Pongo abelii | SUMO2P8 |
 |
Green monkey | Chlorocebus sabaeus | SUMO2P3 |
 |
Crab-eating macaque | Macaca fascicularis | SUMO2P10 |
 |
Rhesus | Macaca mulatta | SUMO2P14 |
 |
Golden snub-nosed monkey | Rhinopithecus roxellana | SUMO2P3 |
 |
Marmoset | Callithrix jacchus | SUMO2P1 |
 |
Mouse lemur | Microcebus murinus | SUMO2P15 |
 |
Dolphin | Tursiops truncatus | SUMO2P5 |
 |
Horse | Equus caballus | SUMO2P6 |
 |
Pale spear-nosed bat | Phyllostomus discolor | SUMO2P6 |
 |
Velvety free-tailed bat | Molossus molossus | SUMO2P8 |
 |
Greater horseshoe bat | Rhinolophus ferrumequinum | SUMO2P5 |
 |
Gibbon | Nomascus leucogenys | Without Homology |
 |
Baboon | Papio anubis | Without Homology |
 |
Mouse | Mus musculus | Without Homology |
 |
Rat | Rattus norvegicus | Without Homology |
 |
Chinese hamster | Cricetulus griseus | Without Homology |
 |
Rabbit | Oryctolagus cuniculus | Without Homology |
 |
Pig | Sus scrofa | Without Homology |
 |
Cow | Bos taurus | Without Homology |
 |
Sheep | Ovis aries | Without Homology |
 |
Dog | Canis familiaris | Without Homology |
 |
Panda | Ailuropoda melanoleuca | Without Homology |
 |
Cat | Felis catus | Without Homology |
 |
Greater mouse-eared bat | Myotis myotis | Without Homology |
 |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
 |
Sloth | Choloepus didactylus | Without Homology |
 |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
 |
Opossum | Monodelphis domestica | Without Homology |
 |
Platypus | Ornithorhynchus anatinus | Without Homology |
 |
Chicken | Gallus gallus | Without Homology |
 |
Turkey | Meleagris gallopavo | Without Homology |
 |
Zebra Finch | Taeniopygia guttata | Without Homology |
 |
Budgerigar | Melopsittacus undulatus | Without Homology |
 |
Painted Turtle | Chrysemys picta | Without Homology |
 |
Lizard | Anolis Carolinensis | Without Homology |
 |
Frog | Xenopus tropicalis | Without Homology |
 |
Zebrafish | Danio rerio | Without Homology |
 |
Drosophila | Drosophila melanogaster | Without Homology |
| >SUMO2P3 |
| TTGAAGGTGGTGGGGCAGGCTGTTGTTGTGGTGCAGTTTAAGAGTAAGAGGCATTTTTATACCACGTAGCAAACTAACAGAAGCCTGTTGTAAATGACAGGGTTTGTCAGTGAGGCAGATAAGCTTCTGATTTGATCGGCAGCCAATCAATGAAACAGACACCTACACAGGAGGAAACGGAGGATGAAGATATAATTGATGTGTTCCAGCAC |
| >SUMO2_x1 |
| ATGGCCGACGAAAAGCCCAAGGAAGGAGTCAAGACTGAGAACAACGATCATATTAATTTGAAGGTGGCGGGGCAGGATGGTTCTGTGGTGCAGTTTAAGATTAAGAGGCATACACCACTTAGTAAACTAATGAAAGCCTATTGTGAACGACAGGGTTTGTCAATGAGGCAGATCAGATTCCGATTTGACGGGCAGCCAATCAATGAAACAGACACACCTGCACAGTTGGAAATGGAGGATGAAGATACAATTGATGTGTTCCAGCAGCAGACAGGAGGTGTCTACTAA |
| PMID - Link | Title |
|---|